ID: 1033056298

View in Genome Browser
Species Human (GRCh38)
Location 7:138058079-138058101
Sequence ATGTCTTTATATAAGAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 590
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 548}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033056298 Original CRISPR ATGTCTTTATATAAGAGAGA GGG (reversed) Intronic
902803185 1:18843862-18843884 AAGTCTTCATATAAGGGAAATGG + Intronic
903136473 1:21312608-21312630 ATTTATTTATTTAAGAGACAGGG - Intronic
905074961 1:35262257-35262279 ATTTATTTATATTAGAGACAGGG - Intergenic
905738230 1:40346218-40346240 ATGTATTTATATAGGGGTGAAGG - Intronic
906769171 1:48468962-48468984 ATGTATTTATTTAAGAGACAGGG + Intronic
907115874 1:51968003-51968025 AAGTGTTTTTATAAGAGACAAGG + Intronic
908717966 1:67090289-67090311 ATGTCTATCTATAAGATAGCTGG - Intergenic
910023045 1:82616194-82616216 AAGTCTTTAAGTAAGAGATAAGG - Intergenic
910245534 1:85134521-85134543 ATCTCTTGATTTTAGAGAGAAGG - Intergenic
910574397 1:88743435-88743457 ATTTCTTTATATAAAACAGTAGG - Intronic
911469015 1:98293268-98293290 ATGTGTGTATGTGAGAGAGAAGG - Intergenic
912253502 1:108035362-108035384 AAGTATATATATATGAGAGAAGG - Intergenic
915173120 1:153992367-153992389 TTTTTTTTTTATAAGAGAGATGG + Intergenic
916567043 1:165990026-165990048 ATGTCCTTCTATAAGTGAGAGGG + Intergenic
917520314 1:175742865-175742887 TTGTCTGTAGATAAGCGAGATGG - Intronic
917728700 1:177852817-177852839 TTGTCTTTATATCAGATACATGG + Intergenic
918009025 1:180569334-180569356 GTGTCTTTATAAGAGAGAGACGG + Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
918909593 1:190549210-190549232 ATGTTTTTATATTAGTGAAATGG + Intergenic
919083647 1:192894782-192894804 ATGACTTTAGATAGGAAAGAAGG + Intergenic
919275720 1:195413904-195413926 GTGTCGTTATAAAAGAGACATGG - Intergenic
919490833 1:198203136-198203158 ATGTATTTATATAAAACTGAAGG + Intronic
919528705 1:198687522-198687544 ATGCCTTTATATATGAAACAAGG - Intronic
919635438 1:199999020-199999042 TTGTCTTTTTAGAAGAGACAGGG - Intergenic
919792823 1:201303188-201303210 ATGTATTTATTTTAGAGACAGGG + Intronic
920026559 1:203002502-203002524 ATTTATTTATTTAACAGAGATGG + Intergenic
922204442 1:223434272-223434294 ATCTCTATATAAAATAGAGATGG - Intergenic
922609272 1:226912344-226912366 ATATCTTAATAGAAGAGAGCTGG - Intronic
923933021 1:238724103-238724125 ATGTCTTTAGAGAATAGAAAAGG - Intergenic
924004712 1:239596091-239596113 ATGTTTTAATAAAAGAGAAATGG - Intronic
924241144 1:242041837-242041859 ATGTGATTATATTAGAGATAGGG - Intergenic
1063689444 10:8272454-8272476 TTATATTTATAGAAGAGAGAGGG + Intergenic
1063706116 10:8432468-8432490 ATTTATTTATTTAAGAGACAGGG - Intergenic
1063779197 10:9301863-9301885 ATTTATTTATATAAGATGGAGGG - Intergenic
1064455232 10:15481582-15481604 ATGTCTTTATTTTAAGGAGATGG + Intergenic
1064546281 10:16453060-16453082 ATTTTTTAATATAATAGAGATGG + Intronic
1065660864 10:28003085-28003107 TTGTCTTTATCTATGAGAGAGGG - Intergenic
1065807216 10:29405324-29405346 ATGTCCTTCTGTAAGAGTGAAGG + Intergenic
1065980509 10:30890503-30890525 ATGGCTTTAGAAAATAGAGAAGG - Intronic
1066061790 10:31730610-31730632 ATGTCTTTATTTTATAGACATGG - Intergenic
1066686298 10:37984707-37984729 TTGTCTTTTTAGTAGAGAGAGGG - Intergenic
1067975397 10:51019233-51019255 ATGATTTTATATAATAAAGATGG + Intronic
1068802942 10:61162583-61162605 TTTTCTTTATATAAGCAAGATGG - Intergenic
1069305074 10:66959015-66959037 ATGTGTATAATTAAGAGAGAAGG - Intronic
1069515107 10:69071065-69071087 ATTTCTTTAAAAAATAGAGATGG + Intergenic
1069554946 10:69391824-69391846 ATGGCTTTATAGCAAAGAGATGG - Intronic
1071118002 10:82246232-82246254 CTGTCTTCAGATAAGGGAGATGG - Intronic
1071578102 10:86744952-86744974 AACTCTTTCTCTAAGAGAGAGGG - Intergenic
1071681595 10:87711555-87711577 ATGTCTTTATTTAAATGAAAAGG + Intronic
1072028330 10:91488719-91488741 ATTTCTTTCTATCACAGAGAAGG + Intronic
1072349060 10:94540155-94540177 ATGTTTGAATATCAGAGAGAAGG - Intronic
1072985105 10:100132593-100132615 ATTTATTTATTTAAGAGACAGGG - Intergenic
1073015610 10:100396744-100396766 CTGTTTTTTTATAATAGAGATGG - Intergenic
1073912825 10:108366827-108366849 ATGCCTTAATATTAGAGAGCAGG - Intergenic
1074260837 10:111851779-111851801 ATGTCTTTAGGTAACAGAAAAGG + Intergenic
1074427319 10:113362913-113362935 ATTTCTGTTTATAAGTGAGAAGG + Intergenic
1075110647 10:119578622-119578644 ATTTATTTATGTAAGAGACAGGG - Intronic
1075618160 10:123906280-123906302 ATGTCTACCTAGAAGAGAGATGG + Intronic
1076118547 10:127918202-127918224 AGGTCTTTAGATAAGAGTCATGG - Intronic
1076282203 10:129257469-129257491 CTTTCTTTTTTTAAGAGAGAGGG - Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078335371 11:10459059-10459081 ATGTCTTGATAGCAGAGAGGGGG - Intronic
1078576878 11:12510038-12510060 ATGTCTTTGTGGCAGAGAGAGGG - Intronic
1080676344 11:34431068-34431090 TTGTATTTTTATAAGAGAGGAGG - Intergenic
1081249452 11:40811875-40811897 ATGTCCTTATATGTGAGATAGGG + Intronic
1082049325 11:47757827-47757849 ATGTATATATGTAAGAGATACGG + Intronic
1082565455 11:54672297-54672319 ATGTCTTTATCCAAGACACATGG + Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1082918125 11:58461470-58461492 ATCTTTTTATCTTAGAGAGAAGG - Intergenic
1083058397 11:59845163-59845185 ATGTTTTTTATTAAGAGAGATGG - Intronic
1084913057 11:72406861-72406883 ATGTATTTATAAAAGAAGGAAGG - Intronic
1084985980 11:72872117-72872139 ACGTCTTTATATAAGACAATTGG + Intronic
1085314060 11:75532857-75532879 ATGTCTTGATAGAAGACAGCTGG + Intergenic
1085327320 11:75616986-75617008 ATCTTTCTATGTAAGAGAGAGGG - Intronic
1086075287 11:82844414-82844436 ATTTATTTTTTTAAGAGAGAAGG - Intronic
1086325732 11:85697208-85697230 ATTTATTTATTTAATAGAGAAGG + Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087858928 11:103129377-103129399 ATGTCTGTATATAAGAAATTAGG + Intronic
1087880501 11:103409961-103409983 ATACCTTTATATAAGATAAATGG + Intronic
1088290271 11:108229684-108229706 ATTTATTTATTTAAGAGATAGGG + Intronic
1088416879 11:109599198-109599220 ATGTGTATATATAACAGAGATGG + Intergenic
1088437310 11:109829209-109829231 ATGTATTCATATAAGAGAAAAGG + Intergenic
1088997431 11:115013702-115013724 ATGTCCTTATAAGAGAAAGATGG + Intergenic
1089194240 11:116683394-116683416 AGGTCTTCATAAGAGAGAGAGGG + Intergenic
1089475466 11:118757403-118757425 ATCTCATGATATGAGAGAGATGG + Intronic
1090144039 11:124299920-124299942 ATTTCTTTAGATAAGAGAGCTGG - Intergenic
1090283214 11:125475796-125475818 AGGTTTTTATCTAAGAGAAATGG + Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1092293191 12:7177580-7177602 AGGTCCTTATATGTGAGAGATGG + Intergenic
1092824948 12:12390049-12390071 ATGGCTTTTTATCAGATAGAAGG - Intronic
1092842130 12:12552645-12552667 ATTTCTTTATAGAAGATAGCTGG - Intronic
1092875534 12:12844253-12844275 ATTTTTTTTTTTAAGAGAGAGGG + Intergenic
1093281525 12:17202182-17202204 ATATCATCACATAAGAGAGAAGG - Intergenic
1093772536 12:23034315-23034337 AAATCTTCATATAAAAGAGATGG + Intergenic
1095742635 12:45623623-45623645 ATGTATTTATTTCAGAGACAGGG + Intergenic
1096752534 12:53770811-53770833 ATATATATATATGAGAGAGAAGG - Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097334566 12:58367789-58367811 CTGTCTCTATATAAGACAGGAGG + Intergenic
1098073155 12:66697835-66697857 ATGTCTATATATTAGACAAATGG + Intronic
1099037724 12:77610303-77610325 ATGTATATATATCAGAGACACGG - Intergenic
1099176587 12:79429377-79429399 TTGTATTTTTATTAGAGAGATGG + Intronic
1099681891 12:85840084-85840106 AAGTCTTTATAGAAGAAAAATGG + Intergenic
1100314763 12:93434908-93434930 ATTTATTTATTTAAGAGACAGGG + Intronic
1100510371 12:95265161-95265183 ATGTGTATATATAAGAAAGAGGG - Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101385619 12:104254802-104254824 ATGTATTTATTTTAGAGACAGGG - Intronic
1102377665 12:112436012-112436034 ATATTTTTATAAAATAGAGATGG - Intronic
1102849624 12:116228196-116228218 GTGTCTTTATGTAAGGGAGATGG - Intronic
1102920993 12:116791478-116791500 ATGTTTGTATTTTAGAGAGATGG + Intronic
1103189109 12:118985479-118985501 ATGTCTTTAAAAATGAAAGAAGG + Intronic
1103638530 12:122329454-122329476 TTGTATTTTTATTAGAGAGAGGG - Intronic
1103654501 12:122459476-122459498 ATTTATTTATTTAAGAGACAGGG - Intergenic
1105567828 13:21568797-21568819 ATGTCTTGCTGTAAGAGAGTGGG - Intronic
1106281277 13:28274220-28274242 ATGTCTCCAGATAAGAAAGAGGG - Intronic
1106471851 13:30063084-30063106 ATCTCTTTATATATGAGTGCAGG + Intergenic
1106935036 13:34708743-34708765 ATGTTTTCCTATAATAGAGAAGG + Intergenic
1107246484 13:38302523-38302545 ATGTCTTTGTTTAAGACACATGG - Intergenic
1107444324 13:40456982-40457004 ATGTCTTTATAGAAGGAAGAGGG + Intergenic
1107606641 13:42064043-42064065 ATGTCCTTATATATGCGAGATGG + Intronic
1107911133 13:45106735-45106757 ATGGCTTAATTTCAGAGAGAAGG - Intergenic
1108550091 13:51535480-51535502 ATGTCTTTATAAAAGTAAGAGGG + Intergenic
1109053478 13:57514690-57514712 AGTTCTGTATATCAGAGAGAGGG - Intergenic
1109332094 13:60942780-60942802 ATTTCTTGATATGAGAGAAATGG + Intergenic
1109491492 13:63106458-63106480 ATGGTTTTATACAAGAAAGACGG + Intergenic
1109860162 13:68187779-68187801 ATGTCATTCTAGAGGAGAGAAGG + Intergenic
1111153606 13:84292892-84292914 ATCTCTTTCTAAAAGAAAGATGG + Intergenic
1111350062 13:87016220-87016242 ATATCTTTATATAAGTCAAATGG + Intergenic
1111652776 13:91113457-91113479 ATTTATTTATTTAATAGAGATGG - Intergenic
1111699393 13:91667344-91667366 ATGTAATTAAATAAAAGAGAAGG - Intronic
1112387648 13:98955143-98955165 TTGTCTTTGTATTAGAGACAGGG - Intronic
1112448345 13:99487605-99487627 AAGTCTTTATGTGAGACAGAGGG + Intergenic
1112486305 13:99823230-99823252 ATTTCTTTAAAAAATAGAGATGG + Intronic
1112509803 13:99998809-99998831 TTGTATTTTTAGAAGAGAGACGG + Intergenic
1112514319 13:100038914-100038936 ATTTATTTATTTAATAGAGAAGG + Intergenic
1112576633 13:100642146-100642168 ATGTCTTTATAGGAGGGAAAAGG + Intronic
1112755687 13:102630480-102630502 ATATCTTTATATAGTAGTGATGG + Intronic
1112801897 13:103120567-103120589 ATTTATTTATTTAAGAGACAGGG - Intergenic
1112883892 13:104144674-104144696 ATGTCCTTATATACATGAGATGG - Intergenic
1114049446 14:18910820-18910842 ATGTCACTACAGAAGAGAGATGG + Intergenic
1114113117 14:19491111-19491133 ATGTCACTACAGAAGAGAGATGG - Intergenic
1114963339 14:27922644-27922666 CTGTTTTGATATAAGAGAGAGGG + Intergenic
1115784547 14:36809712-36809734 ATGTTTTTAAATAAAAGAAAAGG + Intronic
1116472191 14:45298193-45298215 ATTTATTTATTTAAGAGACAGGG - Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1116715505 14:48420535-48420557 GTGTCCATATATAAGAAAGAGGG - Intergenic
1116982453 14:51186079-51186101 ATTTTTTTAAAGAAGAGAGAAGG - Intergenic
1117476165 14:56097060-56097082 AAGTCTTTTTCTAAGAAAGAAGG + Intergenic
1117784890 14:59272657-59272679 ATGTATGTATGTAGGAGAGAGGG + Intronic
1118414223 14:65516171-65516193 TTTTCTTTTTATAAGAGACAAGG - Intronic
1119580537 14:75775392-75775414 AAGGCATTATATAACAGAGATGG - Intronic
1120088636 14:80305593-80305615 GGGTCTTTATATAAGTGAGAAGG + Intronic
1120450998 14:84666565-84666587 TTTACTTTAAATAAGAGAGAGGG + Intergenic
1122252640 14:100450770-100450792 ATGTCTTAGGATAAGAGAGTAGG + Intronic
1123389099 15:19851392-19851414 TTGTATTTTTATTAGAGAGAGGG + Intergenic
1123540670 15:21286541-21286563 AAGCCCTTTTATAAGAGAGATGG + Intergenic
1124122234 15:26897684-26897706 ATGTCTTTTAATCATAGAGAGGG + Intronic
1124498731 15:30207833-30207855 AAGTCCTTATTTAAGAAAGAAGG - Intergenic
1124744848 15:32330843-32330865 AAGTCCTTATTTAAGAAAGAAGG + Intergenic
1125257764 15:37785671-37785693 ATCTATTTATAAAAGAGGGATGG - Intergenic
1125301305 15:38255793-38255815 ATGGCTTTAAAAAAGAGAAAAGG - Intronic
1126120835 15:45249868-45249890 ATGTATTTATTTTAGAGACAGGG - Intergenic
1126385686 15:48091062-48091084 ATTTCTTATTATAAGGGAGAGGG - Intergenic
1126568038 15:50120287-50120309 ATTTCTGGAAATAAGAGAGATGG + Intronic
1126945216 15:53811874-53811896 ATTTCCTTATATATGTGAGACGG + Intergenic
1127729401 15:61784940-61784962 ATTTATTTATTTAAGAGACAAGG + Intergenic
1127742623 15:61927411-61927433 ATGTTTTTCTATAACAGATATGG + Intronic
1127926594 15:63550190-63550212 TTGTATTTTTAGAAGAGAGAGGG + Intronic
1129490350 15:75919142-75919164 TTGTCTTTTTATTAGAGATAGGG + Intronic
1130804162 15:87301173-87301195 GTGTCTTTACATGACAGAGAGGG + Intergenic
1132341807 15:101083637-101083659 CTGTCCTTATGTCAGAGAGATGG - Intergenic
1202948981 15_KI270727v1_random:13684-13706 AAGCCCTTTTATAAGAGAGATGG + Intergenic
1133068267 16:3226224-3226246 TTGTATTTATAGTAGAGAGAGGG + Intronic
1133482360 16:6183563-6183585 ATGCTGTTATATATGAGAGAGGG + Intronic
1133619743 16:7514767-7514789 ATCTCTGTATTGAAGAGAGAAGG - Intronic
1135388057 16:22062331-22062353 ATTTATTTATTTTAGAGAGAGGG + Intronic
1136050612 16:27647344-27647366 CTGTCTTTAAATAAAAGAAAGGG - Intronic
1136389811 16:29956802-29956824 ATGTATTTATTTTAGAGACAGGG + Intronic
1138138627 16:54546799-54546821 ATGCCTTTGGATAAGGGAGATGG + Intergenic
1138409193 16:56824522-56824544 ATCTCTTTATTTTAGAGACAGGG + Intronic
1138952906 16:61935057-61935079 AGGCCTTTATATAAGAGAGGAGG + Intronic
1139523662 16:67499856-67499878 ATATATTTTTATAAGAGACAGGG - Intergenic
1139834425 16:69826703-69826725 TTGTATTTTTATTAGAGAGAGGG - Intronic
1139899925 16:70320276-70320298 GTTTCTTTATTTAATAGAGATGG + Intronic
1140433436 16:74924789-74924811 ATTTCTTTTTTTAATAGAGATGG + Intronic
1141105922 16:81233662-81233684 ATTTATTTATTTAAGAGACATGG - Intergenic
1141416311 16:83878077-83878099 ATGTCTCTATTTTAGACAGAGGG - Intergenic
1143437037 17:6936768-6936790 AAGTCTTTATGTGAGACAGAGGG + Intronic
1143764001 17:9125610-9125632 ATTTATTTATTTAAGAGAGGAGG + Intronic
1143821256 17:9565441-9565463 TTGTATTTTTATTAGAGAGAGGG - Intronic
1146381040 17:32327664-32327686 ATTTCTTTATATTTGAGAGAGGG + Intronic
1146640316 17:34535876-34535898 AGACCTTTATATAAGAAAGAGGG - Intergenic
1146894386 17:36530927-36530949 ATTTATTTATTTAAGAGACAGGG + Intronic
1147117601 17:38313390-38313412 ATATATATATATATGAGAGATGG + Intronic
1147150903 17:38513065-38513087 ATGTATATATATAATAGAGGAGG - Intergenic
1147943232 17:44065260-44065282 ATGTTTTTTTTTAACAGAGATGG - Intronic
1148412086 17:47476266-47476288 ATATATATATATATGAGAGATGG - Intergenic
1149087822 17:52740312-52740334 ATGTATTTATTTTAGAGACAGGG - Intergenic
1149262622 17:54896441-54896463 TTGTCTTTTTATTAGAGACAGGG - Intergenic
1149405547 17:56346570-56346592 ATGTCTTTATTCAAGAAAAATGG - Intronic
1150497679 17:65621097-65621119 TTGTATTTTTAGAAGAGAGAGGG - Intronic
1151461872 17:74259214-74259236 TTGTTTTTTTTTAAGAGAGAGGG + Intronic
1151838642 17:76601326-76601348 ATGTATTTATTTTTGAGAGAGGG - Intergenic
1153093845 18:1378968-1378990 ATGTATTTATGAGAGAGAGAAGG + Intergenic
1153365657 18:4252866-4252888 ATGACTTTGTTTAAGAGAAAAGG - Intronic
1154219642 18:12440940-12440962 ACTTCTTTTTCTAAGAGAGAGGG - Intergenic
1154331483 18:13432721-13432743 ATTTATTTATTTAAGAGACAGGG + Intronic
1154383852 18:13875896-13875918 ATGTCTTCTCCTAAGAGAGATGG + Intergenic
1155787501 18:29918885-29918907 AAGTATTTTTATCAGAGAGAAGG - Intergenic
1155952606 18:31929518-31929540 ATGTTTTTTTAAAAGAGACAAGG - Intronic
1155966267 18:32038220-32038242 TTGTCTTTTTAGTAGAGAGAGGG + Intronic
1156080368 18:33326799-33326821 ATGTCTTCGAATGAGAGAGAAGG - Intronic
1156608259 18:38694885-38694907 ATGTCTGTTTATATGATAGAAGG + Intergenic
1156690451 18:39700835-39700857 ATGTATTTGTATGGGAGAGAAGG + Intergenic
1157932154 18:51834873-51834895 ATTACTTTATATAAGAAAAAAGG - Intergenic
1159146638 18:64462982-64463004 ATGTATTTATATAAGAAACTAGG + Intergenic
1159348009 18:67232035-67232057 ATTTCTCTATATAAAAGAGGAGG - Intergenic
1159508877 18:69370162-69370184 ATGTCTTTCTCTAAGAGCTATGG - Intergenic
1160262929 18:77312438-77312460 ATGCCTTTCTAGAAGAGTGAAGG + Intergenic
1160895958 19:1401926-1401948 CTGTCTTTTTTTAATAGAGACGG + Intergenic
1161496005 19:4586018-4586040 ATGTATTTAGTTAAGAGACAGGG - Intergenic
1161730284 19:5956100-5956122 ATGTTTTTATCTTTGAGAGACGG - Intronic
1162083014 19:8230360-8230382 TTGTATTTTTATTAGAGAGAGGG + Intronic
1162616070 19:11801165-11801187 ATTTATTTATTTAATAGAGACGG - Intronic
1162642352 19:12021686-12021708 ATCTCTCTTTATAAGAGATAGGG + Intronic
1162840283 19:13351348-13351370 ATGTGTTTATTTAAGAGATGGGG + Intronic
1163348194 19:16758281-16758303 ATGTATTTATTTTAGAGACAGGG + Intronic
1165311685 19:35032326-35032348 ATTTCTTTCAACAAGAGAGAGGG + Intronic
1165493506 19:36139353-36139375 TTGTTTTTACATAATAGAGACGG - Intergenic
1166153933 19:40896484-40896506 GTGTCTGTATAAAAGAGAGGCGG - Intronic
1166759192 19:45213770-45213792 ATGTATTTTTAGTAGAGAGAGGG - Intronic
1167585747 19:50374538-50374560 ATGCCTTTATAAAAAAGAAATGG - Intronic
925493616 2:4422700-4422722 ATCACTTTATAGAAGAAAGAAGG + Intergenic
925604652 2:5646694-5646716 ATTTGTTTATATAAAAGATATGG - Intergenic
926283438 2:11468660-11468682 TTGTATTTATAGAAGAGACAGGG - Intergenic
927222577 2:20727202-20727224 ATTTATTTATATTAGAGACAGGG - Intronic
927586078 2:24306675-24306697 ACTTCTTTTTATTAGAGAGATGG + Intronic
927802800 2:26116869-26116891 TTTTCTTTTTTTAAGAGAGAGGG + Intronic
927993653 2:27466270-27466292 CTGTCTTTTTCTGAGAGAGAAGG - Intronic
928021050 2:27705400-27705422 ATTTTTTTTTTTAAGAGAGATGG + Intergenic
928340133 2:30435633-30435655 TTGTATTTTTATTAGAGAGAGGG - Intergenic
928459323 2:31456095-31456117 ATGTCTTTCTATTAGAAAGAGGG - Intergenic
928624100 2:33121865-33121887 TAGTCTTTATAGGAGAGAGAAGG + Intronic
928648397 2:33379381-33379403 TTGTATTTTTATTAGAGAGAGGG + Intronic
929002700 2:37363622-37363644 ATTTATTTATTTAAGAGACAGGG - Intronic
929553278 2:42907543-42907565 ATGTCTTTATTTTAGAGATGGGG - Intergenic
929974151 2:46616226-46616248 ATTTCCTTATACCAGAGAGATGG - Intronic
930093133 2:47546085-47546107 AAGTTTTTGAATAAGAGAGAGGG - Intronic
930321780 2:49863958-49863980 ATGTCTTTACACAAAAGAAAAGG - Intergenic
930354532 2:50300866-50300888 TTGTCTTTGTATTAGAGAGGGGG + Intronic
931231668 2:60380319-60380341 ATGTCTTTATATCAGAAGTAGGG - Intergenic
931728680 2:65133905-65133927 ACGTATCTATATCAGAGAGAGGG - Intergenic
932124452 2:69131176-69131198 CTATCTTTATATCAGAAAGAGGG - Intronic
932219727 2:69990354-69990376 TTGTATTTATATTAGAGATAGGG + Intergenic
933666492 2:84969503-84969525 ATCTCTTTCTACAAGAGAAATGG + Intergenic
933968243 2:87448153-87448175 AAGTCTCTAAATAAGTGAGAAGG + Intergenic
934726906 2:96627712-96627734 ATGACTTTATATAAGAAGAAAGG + Intronic
935656705 2:105429422-105429444 GTGTCCTTATATATGAAAGATGG + Intronic
935996474 2:108779463-108779485 ATGTTTTTAAAGAGGAGAGAGGG - Intronic
936325554 2:111502351-111502373 AAGTCTCTAAATAAGTGAGAAGG - Intergenic
936620224 2:114088484-114088506 ATTTCTATATATGAGACAGAGGG - Intergenic
937662621 2:124447699-124447721 ATGTATTTATATAGGAAACAGGG + Intronic
937945166 2:127327699-127327721 TTGTTTTTATAAAAGGGAGATGG - Intronic
938724395 2:134094219-134094241 ATGTCTGTAGGTAAGAAAGATGG - Intergenic
938755420 2:134374818-134374840 ATGTATTTTTAGAAGAGATAGGG - Intronic
938985088 2:136567360-136567382 AGGTCTTCATTTATGAGAGAAGG - Intergenic
939139836 2:138341570-138341592 ATCTCTTTGCATAAGAGAAAAGG - Intergenic
939285144 2:140120163-140120185 AGGTATTTATATACGAGTGATGG + Intergenic
939364094 2:141210440-141210462 TTGTCTTTATGGAAGAAAGAAGG - Intronic
939920985 2:148112984-148113006 ATTTATTTATTTAAGAGACAGGG - Intronic
940122777 2:150285801-150285823 ATTTTTTTATATAATTGAGAAGG - Intergenic
940179416 2:150915396-150915418 ATTTATTTATTTAAGAGACAGGG + Intergenic
940955487 2:159722308-159722330 TTGTATTTATAGTAGAGAGAGGG + Intronic
941232825 2:162932284-162932306 ATGTATTTAGAGAAGATAGAGGG - Intergenic
941280845 2:163548875-163548897 ATATCTTTCTATATGAAAGATGG + Intergenic
941640829 2:167986526-167986548 CTCTCTTTATCTAAGAGGGAAGG - Intronic
942180429 2:173375199-173375221 ATTTGTTTATTTAAGAGACAGGG + Intergenic
942348206 2:175025569-175025591 AGGTATTTATGTAAGAGAAATGG - Intergenic
942544419 2:177047966-177047988 TTCTCTTTCTAAAAGAGAGAAGG - Intergenic
942559933 2:177209741-177209763 ATGTCATGATATAAAGGAGAGGG + Intergenic
942886588 2:180932402-180932424 ATGTAATTATATCAGGGAGAAGG + Intergenic
942933238 2:181522121-181522143 TTGTATGCATATAAGAGAGAGGG + Intronic
943536307 2:189154984-189155006 ATTTATTTATTTTAGAGAGAGGG + Intronic
943564883 2:189505606-189505628 CCGTCTTTATCTAAGAGAAATGG + Intergenic
943993502 2:194729813-194729835 TTGTCTGTTTATAAAAGAGATGG - Intergenic
944046976 2:195423432-195423454 AAGTTTTTATGTAAGAGAGGAGG - Intergenic
944200079 2:197097552-197097574 ATGTCTTTTTACAGAAGAGAGGG - Intronic
946491163 2:220150539-220150561 ATGTATTAATATTAGATAGAAGG - Intergenic
947147529 2:227081917-227081939 ATGTTTTCAAATAAGAGACAGGG + Intronic
947300188 2:228680479-228680501 ATATGTTAATATATGAGAGATGG - Intergenic
947785102 2:232810407-232810429 ATATATGTATATAAGCGAGAGGG + Intronic
948119558 2:235519077-235519099 ATGTGTTTATTTATGAGACAGGG + Intronic
948269160 2:236660989-236661011 TTTTCTTTAAATAAGAGAAAAGG - Intergenic
948331420 2:237169524-237169546 AAGTCTTTGAAGAAGAGAGAGGG + Intergenic
948424921 2:237881133-237881155 AACCCTTTATATAAGAAAGAAGG - Intronic
948742951 2:240060202-240060224 CTGTCTTCAAATAAGAGGGACGG - Intergenic
1169222009 20:3829426-3829448 TTGTATTTTTAGAAGAGAGAGGG + Intergenic
1169419404 20:5447704-5447726 ATTTCATTTCATAAGAGAGATGG - Intergenic
1169525874 20:6424897-6424919 TTGTATTTTTATTAGAGAGAGGG - Intergenic
1169688924 20:8308442-8308464 TTGTGTTTTTATTAGAGAGAGGG - Intronic
1169773388 20:9225753-9225775 ATCTGCTTCTATAAGAGAGAGGG + Intronic
1169950552 20:11038717-11038739 GTGTCTTTATATCAGGGAAAAGG + Intergenic
1170019768 20:11824099-11824121 ATATGTTTATATAATAAAGAGGG - Intergenic
1170127129 20:12976245-12976267 ATGCCTTTAAGGAAGAGAGAAGG - Intergenic
1170239261 20:14145089-14145111 ATGTATCTATACAAGGGAGAAGG - Intronic
1170677801 20:18498521-18498543 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1171302672 20:24077549-24077571 ATGTCCTTATATGACAGGGAAGG + Intergenic
1171325062 20:24283931-24283953 ATGTCTTTATAGCAGTGTGAGGG - Intergenic
1172830481 20:37829836-37829858 ATGTATTTATTTAGGAGACAGGG + Intronic
1174227588 20:49014751-49014773 ATTTATTTATTTAAGAGATATGG - Intronic
1175000615 20:55624501-55624523 ATGTATATATATGAGAGACAGGG - Intergenic
1175335344 20:58192597-58192619 ATGTCTGTATCCAAGAGAGCAGG + Intergenic
1176900801 21:14439417-14439439 TTGTATTTTTATTAGAGAGAGGG + Intergenic
1177340065 21:19786810-19786832 ATGACTTCATATATGGGAGATGG + Intergenic
1177370352 21:20195800-20195822 TTAACTTTATATAAGACAGAAGG + Intergenic
1177475625 21:21617597-21617619 ATGTCATTATTTCAGAGAGGTGG + Intergenic
1178174924 21:30085774-30085796 ATGTCTTTTCCTATGAGAGAAGG - Intergenic
1178711640 21:34922399-34922421 CTGTCTTTATATCAAAGACAAGG + Intronic
1178870537 21:36370839-36370861 TTGTCTTTTTATTAGAGACAGGG + Intronic
1178978341 21:37240125-37240147 ATGTCTTTTTTTAAGAGACATGG + Intronic
1179267206 21:39814217-39814239 ATGTCTTTATTAAAGAGAACAGG - Intergenic
1180511768 22:16098289-16098311 TTGTATTTTTATTAGAGAGAGGG + Intergenic
1180714885 22:17865117-17865139 ATTTATTTATTTAAGAGACAGGG + Intronic
1181785776 22:25225544-25225566 AGGTCTCTATCCAAGAGAGAAGG + Intronic
1182243732 22:28938203-28938225 ATGTCTTAAAATAAGATGGATGG - Intronic
1184555577 22:45231076-45231098 ATGTATTTTTAGTAGAGAGATGG - Intronic
1184990184 22:48162276-48162298 ATGTATTTATTTCAGAGAGAAGG - Intergenic
949734548 3:7156581-7156603 ATGTTTTCATATAACAGATATGG - Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951638718 3:24810025-24810047 TTGTCCTTAAATAAGAGACAGGG + Intergenic
951959747 3:28304185-28304207 ATGTATTTTTTTAAGAGACAGGG - Intronic
951992631 3:28692675-28692697 ATTTATTTATTTAAGAGACAGGG + Intergenic
952329583 3:32351820-32351842 AGATCTTTACATAAGAGAGATGG - Intronic
952361538 3:32635122-32635144 ATATCTTTATTTAAGACAAATGG + Intergenic
952600183 3:35070581-35070603 ATGTATATATATAAGCCAGAAGG - Intergenic
952721861 3:36541974-36541996 GTCTCTTTATGTTAGAGAGAGGG + Intronic
953191089 3:40688765-40688787 AAGTCATTATATGAGAAAGAGGG + Intergenic
953472107 3:43176537-43176559 ATGTGTTTATATTTTAGAGATGG - Intergenic
953810494 3:46108503-46108525 ATGTTTTTATATCAAAGAGACGG - Intergenic
954343710 3:49978005-49978027 ATTTTTTTTTATAAGAGAAAGGG + Intronic
955186923 3:56723193-56723215 CTGTCATTATATCAGTGAGAGGG - Intergenic
955230311 3:57093297-57093319 CTGTCTTTATTGAAGAGAAATGG - Exonic
955309418 3:57869621-57869643 ATATATATATATAATAGAGATGG - Intronic
956223231 3:66926268-66926290 AGGTCTTTATATAATAATGAAGG + Intergenic
956562955 3:70602379-70602401 ATGTCTATATTTTAGAGACATGG + Intergenic
957406638 3:79780442-79780464 ATGTCTTTCTGCAAGACAGATGG - Intergenic
957803915 3:85121887-85121909 ATGTCAATATATGTGAGAGAGGG - Intronic
959776949 3:110176856-110176878 ATGCCCTTATAAAAGAGAAAGGG - Intergenic
960285020 3:115818755-115818777 ATATATATATATAAGAAAGAAGG + Intronic
960333052 3:116386475-116386497 CTCTCTTTCTCTAAGAGAGATGG + Intronic
961152009 3:124647074-124647096 ATTTTTTTATTTAATAGAGATGG + Intronic
961791329 3:129378824-129378846 AGGGATTTATAAAAGAGAGAAGG + Intergenic
961851320 3:129822054-129822076 ATGTATTTATATTTGAGACAGGG - Intronic
962042767 3:131724430-131724452 ATGTATTAATATCTGAGAGAGGG - Intronic
962149402 3:132877035-132877057 ATGTCTAGATATAAGAGAGTAGG + Intergenic
963488343 3:145965859-145965881 AAGTCTTCAAATAAGAGAGTAGG - Intergenic
963543525 3:146625607-146625629 ATATCTTGATAAAAGAGTGAGGG + Intergenic
963576623 3:147068406-147068428 ATGTCCTTTTAGAAGAGGGAAGG - Intergenic
963582532 3:147144332-147144354 ATGTCTTAAAATGACAGAGAAGG - Intergenic
963995783 3:151706773-151706795 ATGTCTTTATGGAAGATAGCTGG + Intergenic
964417570 3:156463537-156463559 TTGTCTTTATTTCAGTGAGATGG + Intronic
964705307 3:159611927-159611949 ATGGAATTTTATAAGAGAGAGGG - Intronic
965227120 3:166003898-166003920 ATGGCTTTATATCAAAGAGATGG + Intergenic
965479041 3:169194184-169194206 ATTTTTTTATATAGCAGAGAAGG - Intronic
965612516 3:170559485-170559507 ATATTTTTATATAAGAGATGCGG + Intronic
965672536 3:171161399-171161421 ATTTATTTATATATAAGAGACGG - Intronic
965874940 3:173305482-173305504 ATGTATTTATTTAAGAGACTGGG + Intergenic
966165515 3:177011894-177011916 GTGTTTTTACATAAAAGAGATGG - Intergenic
966384822 3:179385085-179385107 ATGTATTTTTATTAGAGACAGGG + Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
966779127 3:183568385-183568407 CTGTATTTTTATTAGAGAGAGGG + Intergenic
967572773 3:191050403-191050425 ATGTGTGTATATAAGAGGAAGGG + Intergenic
968165718 3:196463620-196463642 ATTTTTTAATATAATAGAGATGG + Intergenic
968260863 3:197323015-197323037 TTGTATTTGTATTAGAGAGAGGG + Intergenic
968379334 4:76238-76260 ATGTATTTATTTTAGAGACACGG + Intronic
968395854 4:237018-237040 ATGTACTTATTTAAGAGACAGGG + Intergenic
968399693 4:282337-282359 ATGTATTTATTTTAGAGACAGGG - Intronic
969219523 4:5750821-5750843 ATGTTTGTATAGAAGAGGGATGG + Intronic
970142559 4:12998123-12998145 ATGTCTTTATCTAAGACAGAGGG - Intergenic
970188587 4:13487856-13487878 ATGTATCCTTATAAGAGAGAAGG + Intergenic
971410120 4:26361820-26361842 ATGTTTTTATGTAAGAAAGCTGG + Intronic
972153471 4:36126131-36126153 ATGACTCTCTATAAGAAAGAGGG + Intronic
973029699 4:45321653-45321675 ATGACTTTATATTACAGACATGG - Intergenic
973634254 4:52847192-52847214 ATGCCTTTAGCTAAGAAAGAAGG - Intergenic
973890424 4:55362459-55362481 TTTTCTTTTTTTAAGAGAGAGGG + Intronic
974034676 4:56807569-56807591 ATTTATTTATTTAATAGAGACGG + Intergenic
974295920 4:59998995-59999017 ATATCTTTCTATCAGAAAGAGGG - Intergenic
974523532 4:63017835-63017857 ATGTCTTTATAGGAGACAAAGGG + Intergenic
975698978 4:77043509-77043531 TTTTGTTTATATAAGAGACAGGG - Intergenic
975701470 4:77070840-77070862 AAATCTTTATATAAAAGAAATGG + Intronic
976942945 4:90728662-90728684 ATGTTTTTAAATAATAGGGAGGG - Intronic
977869095 4:102068652-102068674 TTGTATTTTTATAAGAGACAGGG - Intronic
977911083 4:102537442-102537464 ATGTCTTTAAGTAAGAGTCAAGG + Intronic
978103208 4:104868799-104868821 ATGTATATATATATGAGACAAGG + Intergenic
978180310 4:105786693-105786715 ATTTCTTCAAATAAGAGATATGG + Intronic
978180473 4:105789205-105789227 AACTCTTTATATAACAGAAAAGG + Intronic
978659926 4:111113337-111113359 ATGTCTTTAGATTATAGAAATGG + Intergenic
979877288 4:125909307-125909329 ATGACTTTATAGAAAAGAAAAGG - Intergenic
980540234 4:134184066-134184088 ATGTCTTCATTTCAGAGAGTGGG - Intergenic
981744936 4:148043604-148043626 ATATATATATATTAGAGAGAGGG - Intronic
981816643 4:148838364-148838386 ATGTCTTTCTTTAAGAGACTGGG - Intergenic
982084840 4:151823946-151823968 ATGTTTTTCTGCAAGAGAGAAGG - Intergenic
983146666 4:164224655-164224677 AATGCTTTATATAAGAGAGCTGG + Intronic
983259436 4:165439749-165439771 ATTTCTATATATAAAAGATAGGG + Intronic
984252379 4:177349496-177349518 AAGTGTCTTTATAAGAGAGAGGG - Intronic
984327299 4:178270712-178270734 ATGTATTTATATCAGAGAGAAGG - Intergenic
985329974 4:188821234-188821256 ATTTATTTGTATAAGACAGAGGG + Intergenic
985341569 4:188960210-188960232 ATGTCTTTCAATATGAGATAAGG - Intergenic
986408008 5:7446521-7446543 ATGTATTTATTTCAGAGACAAGG - Intronic
986430003 5:7672499-7672521 ATTTTTTTTTTTAAGAGAGAGGG + Intronic
986873977 5:12083398-12083420 ATGTCTTTAAAAAGGTGAGATGG - Intergenic
987002761 5:13677069-13677091 GTGTCTTTGTAAGAGAGAGAAGG + Intergenic
987475859 5:18391979-18392001 ATGTCTTTGCATCAGTGAGACGG + Intergenic
988386877 5:30576087-30576109 AAGTGTTTATATAAGAAAAATGG + Intergenic
989321013 5:40133566-40133588 ATGTGATTATATTAGAGAGTGGG - Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
990546809 5:56830389-56830411 ATGTGTTTAAGAAAGAGAGAGGG - Intronic
991047920 5:62242355-62242377 ATGTCCTTATATAATAAAAAAGG - Intergenic
991475537 5:67015009-67015031 ATGTCTCTATATCCGAGAAATGG - Intronic
991514573 5:67420477-67420499 ATGTCTTTATAGGAGAAAAATGG + Intergenic
991905764 5:71509073-71509095 TTGTCTGTATAAAAGATAGAAGG + Intronic
992539860 5:77753518-77753540 AGGCCTTCATAAAAGAGAGAAGG + Intronic
992700109 5:79333514-79333536 ATGTCCTTACATAAAAGAAATGG + Intergenic
992733300 5:79693512-79693534 TTGTATTTTTATAAGAGACAGGG + Intronic
993747994 5:91625657-91625679 ATGTCTTTATAAAAGAGGCCAGG + Intergenic
994675384 5:102814911-102814933 ATGGATTTGTATAAGAAAGAGGG - Intronic
995472057 5:112512836-112512858 ATGTGTTTATTCAAGAAAGATGG - Intergenic
995870246 5:116737036-116737058 ATATCTTTTTATAGGTGAGAAGG + Intergenic
995877421 5:116805001-116805023 ATGTATTTATATAAAATTGAAGG + Intergenic
995900191 5:117056542-117056564 ATGTCTTTATAGAATGAAGAAGG - Intergenic
995912386 5:117203227-117203249 TTGTATTTTTATTAGAGAGAGGG - Intergenic
996260412 5:121460054-121460076 ATTGTTTTATATAAGAGATATGG + Intergenic
996740507 5:126794507-126794529 ATGGCTAGATATAAGAGACATGG + Intronic
996870450 5:128186047-128186069 ATATATTTTTTTAAGAGAGATGG - Intronic
996986270 5:129568813-129568835 ATTTATTTATTTAAGAGACAAGG - Intronic
998944640 5:147325321-147325343 ATATATATATATTAGAGAGATGG + Intronic
999683594 5:154082509-154082531 ATGACTTTAAATCAGAGAGAAGG - Intronic
999800576 5:155030225-155030247 ATGTGTTTTTATAAGTGAGGTGG - Intergenic
1000552020 5:162678636-162678658 AATTCTTTATATAAGCAAGAGGG + Intergenic
1000926868 5:167204664-167204686 AGGACTTTATGTCAGAGAGAAGG + Intergenic
1001061313 5:168491540-168491562 ATTTCTTCATATGATAGAGAGGG + Intronic
1003091653 6:3109000-3109022 ATATCTTTGTAGGAGAGAGAAGG - Intronic
1003609302 6:7594604-7594626 ATTTCTTTATAAAATGGAGATGG + Intronic
1003780542 6:9420253-9420275 ATGACTTTATAAATGAGAGGCGG + Intergenic
1004135507 6:12962225-12962247 GTGTCTTTATAGAAGAGATTAGG - Intronic
1004470758 6:15927024-15927046 ATTTTTTTATTTAATAGAGATGG - Intergenic
1005567174 6:27107857-27107879 ATGTCTTTCTATAAGGCAAAGGG - Intergenic
1005639408 6:27781807-27781829 ATGCCTTTTTAGAAGAGTGAAGG - Intergenic
1005917093 6:30362378-30362400 ATGTATTTTTATAAAAGACAAGG + Intergenic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1007492753 6:42236647-42236669 ATATCTTTATATAAGTGATGAGG - Intronic
1008315635 6:50036755-50036777 AAGTCTTTATAAAAGGAAGATGG + Intergenic
1008412435 6:51195669-51195691 ATGTCTTTATATGGCAAAGAGGG + Intergenic
1008446794 6:51600976-51600998 ATGTCCTTGTTTTAGAGAGAAGG - Intergenic
1008571271 6:52819377-52819399 ATTGCTTCATATCAGAGAGAAGG + Intergenic
1009303280 6:62054565-62054587 ATGTCTTTTTAAAAGAAAGAAGG + Intronic
1009444131 6:63719968-63719990 ATGTCTTACTATAAAAGATAAGG + Exonic
1010188247 6:73166866-73166888 ATGTCTTTATGAAACAGAAAAGG - Intronic
1010203382 6:73301801-73301823 TTTTTTTTATATAAGAGAGAGGG + Intronic
1010852748 6:80797969-80797991 ATGTCTGTACATATGAGAGCAGG - Intergenic
1012274546 6:97256938-97256960 ATTTATTTTTTTAAGAGAGAAGG - Intronic
1012476552 6:99620037-99620059 ATGGCTTTACATAACAGCGAAGG + Intergenic
1012883448 6:104817636-104817658 CTGTCTTTGTAGAAGAGAGTAGG + Intronic
1013204153 6:107931573-107931595 TTGTCTTTTTAGTAGAGAGAGGG - Intronic
1013212648 6:108000694-108000716 ATTTATTTATTTAAGAGACAGGG - Intergenic
1013554372 6:111241298-111241320 ATGTATTTATATAGAAGAGTGGG - Intergenic
1014014125 6:116510287-116510309 ATGTATTTATTTATGAGACAGGG + Intronic
1014861471 6:126472642-126472664 ATGTATTTATCAAAGAGAAAAGG - Intergenic
1015125601 6:129750928-129750950 ATGTGTGTATATGAGAGACAGGG + Intergenic
1015738967 6:136432910-136432932 ATTTATTTATTTAAGAGATAGGG + Intronic
1015921370 6:138269403-138269425 CTATCTTTATATAATACAGAAGG + Intronic
1016221047 6:141669830-141669852 ATTTCTTTATTTAGTAGAGATGG - Intergenic
1016283481 6:142447076-142447098 ATGTTTTTATATGAGAGAAATGG - Intergenic
1016704532 6:147091352-147091374 ATTTATTTATTTAAGAGACACGG + Intergenic
1017309145 6:152956449-152956471 ATTTCTTTTTTTAATAGAGACGG - Intergenic
1017961319 6:159223664-159223686 TTGTCTTTATATATGAGAGATGG + Intronic
1019946018 7:4330027-4330049 ATTTATTTATTTAATAGAGATGG + Intergenic
1020269729 7:6587226-6587248 AGGTCTTTATATAATAATGACGG + Intronic
1020871634 7:13637834-13637856 AGTTCTTTATAGAATAGAGATGG - Intergenic
1021422168 7:20458013-20458035 ATTTATATATATAAGAGACAGGG + Intergenic
1021760259 7:23896624-23896646 ATGTATTTATTTTAGAGACAGGG - Intergenic
1021806781 7:24365186-24365208 ATGTCTTCTTATAAGAAACAAGG - Intergenic
1022621473 7:31988685-31988707 ATTTGTTTTTATAAGAGACAGGG - Intronic
1023658884 7:42453414-42453436 ATGTCTTTACAAAAGGAAGATGG + Intergenic
1025072199 7:55910031-55910053 ATGTATTTTTTTAAGAGACAGGG + Intronic
1025120728 7:56299405-56299427 AAGTGTATATAAAAGAGAGAAGG - Intergenic
1025911334 7:65831285-65831307 GAGTCTTTATAAAAGAAAGAGGG + Intergenic
1026350018 7:69507729-69507751 ATTTATTTTTATAAGAGACAAGG + Intergenic
1026526196 7:71155444-71155466 TTGTATTTTTATTAGAGAGAGGG + Intronic
1026707163 7:72704259-72704281 TTGTCTTTATAGTAGAGACAGGG - Intronic
1027498290 7:78916003-78916025 ACGTTTTTATATAAGAGAGATGG + Intronic
1028129589 7:87153497-87153519 ATGTCTTTATATAAAATACTCGG + Intronic
1028632642 7:92951875-92951897 ATGTATTTATTTTAGAGATATGG - Intergenic
1028807069 7:95040016-95040038 AGATCTTGAAATAAGAGAGACGG + Intronic
1029043866 7:97606284-97606306 ATGTATATGTATGAGAGAGAGGG - Intergenic
1029416322 7:100445430-100445452 ATGTATTTTTATTAGAGACAGGG + Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030056852 7:105590777-105590799 ATTTATTTATTTAAGAGACAAGG + Intronic
1030534686 7:110751255-110751277 ATCTCATTATATATGATAGACGG + Intronic
1031891776 7:127302850-127302872 ATGTATTTATTTTAGAGACAGGG + Intergenic
1032169280 7:129570930-129570952 ATATTTTTAAATAATAGAGATGG + Intergenic
1032992539 7:137409912-137409934 ATATGTTTGTATGAGAGAGAGGG - Intronic
1033056298 7:138058079-138058101 ATGTCTTTATATAAGAGAGAGGG - Intronic
1033064899 7:138145259-138145281 CTGTCTTATTATAAGAGACATGG + Intergenic
1033481584 7:141747181-141747203 ATGTCTTTAAATGAGATAGATGG + Intronic
1033620970 7:143061780-143061802 ATGACTTTCTATAAGAGGGTTGG + Intergenic
1033835566 7:145306666-145306688 CTGTCTCTATATAACACAGAAGG + Intergenic
1034107666 7:148504380-148504402 ATCTCTTTGGATAGGAGAGAGGG + Intergenic
1034135368 7:148762972-148762994 TTGTATTTTTATTAGAGAGAGGG - Intronic
1034392299 7:150796192-150796214 ATGTCTTTAGAACAAAGAGAAGG - Intronic
1035989736 8:4476530-4476552 ATGTATTTATAAAACAGAAAGGG + Intronic
1036902950 8:12685438-12685460 ATCTTTTTCTAAAAGAGAGAAGG - Intergenic
1037236715 8:16728825-16728847 ATGACTTTAAGAAAGAGAGATGG + Intergenic
1037416824 8:18660174-18660196 GTGTCTTTATAGAAGGCAGACGG + Intronic
1037726797 8:21489273-21489295 TTATCTTTATATAAGAAGGAGGG - Intergenic
1037759329 8:21731448-21731470 ATGACTTTGGAAAAGAGAGAAGG - Intronic
1038166500 8:25089857-25089879 ATTTATTTATTTTAGAGAGAGGG - Intergenic
1039605664 8:38878212-38878234 ATGTCTTTATTATAGAGACAGGG + Intergenic
1039694930 8:39900695-39900717 AAGTGTTGATATAAGACAGAGGG + Intergenic
1039957545 8:42218819-42218841 ATTTATTTATTTAAGAGACAGGG - Intergenic
1040456190 8:47600344-47600366 TTGTCTTTATATTAGAGATGGGG - Intronic
1041562742 8:59238621-59238643 ATGACTTTAGATAAGAAGGAAGG + Intergenic
1042286987 8:67124368-67124390 ATGACCTTATATTAGAGAAAAGG - Intronic
1042320361 8:67469032-67469054 AAGTCTTCATAGAGGAGAGAAGG - Intronic
1042559864 8:70065305-70065327 ATTCCTGTAAATAAGAGAGAAGG - Intronic
1042807605 8:72788770-72788792 ATGTGTGTATCTAAGAAAGAAGG - Intronic
1043005053 8:74808575-74808597 ATGTCTTTATGTAACAGGCAAGG + Intronic
1043607480 8:82019755-82019777 ATGTCTTTATAGCAGTGTGAAGG + Intergenic
1044497820 8:92910740-92910762 AGGTCATTATATAATAGAAAAGG + Intronic
1045429901 8:102103861-102103883 AAGTTTTTAAATAAGTGAGAAGG + Intronic
1045996945 8:108374104-108374126 ATTTTTTTATTTTAGAGAGAGGG - Intronic
1046107719 8:109686387-109686409 ATGTTTTTCCACAAGAGAGAAGG - Intronic
1046253282 8:111662614-111662636 ATGTCTTTATCTAATGCAGAGGG - Intergenic
1048899133 8:139021423-139021445 ATGTGTGAATATAATAGAGATGG + Intergenic
1049908338 9:240849-240871 ATTTTTTTATTTAAGAGATAAGG - Intronic
1050559760 9:6822799-6822821 ATGTCTGTAGAAAAGACAGAAGG + Intronic
1050642513 9:7683477-7683499 CTGGCTCTTTATAAGAGAGAGGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1050711898 9:8474720-8474742 TTCTCTTTATATAAGAGATGAGG - Intronic
1050846114 9:10221616-10221638 ATGTCTTTATATTAGAGTTGAGG + Intronic
1051971152 9:22889351-22889373 ATGTCTTGATTTTAGAGAAAAGG - Intergenic
1052037469 9:23699056-23699078 ATGTCTTTCTATAGGAGTGAAGG + Intronic
1052124861 9:24762877-24762899 ATGTCTTTTTATTAGAGACTAGG + Intergenic
1052456987 9:28712357-28712379 AAGTTTTTATATATAAGAGATGG - Intergenic
1052472922 9:28922929-28922951 ATGTCTTTATAAAAGGGAGGTGG + Intergenic
1052630867 9:31036775-31036797 AATACTTTGTATAAGAGAGAAGG + Intergenic
1052758839 9:32569047-32569069 ATTTCTTAATATAAGATAGCAGG - Intronic
1053835673 9:42132434-42132456 ATGTGTTTATATATGAGCCAAGG - Intergenic
1054594956 9:67056171-67056193 ATGTGTTTATATATGAGCCAAGG + Intergenic
1054915957 9:70495455-70495477 ATGTCTTTGGCTAAGAGTGAGGG + Intergenic
1055118001 9:72626046-72626068 ATACCTATATATAAGAGAGATGG + Intronic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1057877989 9:98772234-98772256 ATGTATCTTTATAAGAGAAAAGG + Intronic
1057972464 9:99571027-99571049 AAGACTTTAGATAAAAGAGAAGG + Intergenic
1058218064 9:102259719-102259741 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1058484920 9:105434165-105434187 TTGTATTTATTTAACAGAGACGG - Intronic
1060500743 9:124152294-124152316 ATGTCCTTATTCAAGACAGAAGG + Intergenic
1060806672 9:126582016-126582038 ATGTCTTTATAAGAGAAAGGAGG + Intergenic
1061705277 9:132448458-132448480 ATTTCTTTATAAAACAGGGATGG + Intronic
1061769700 9:132909071-132909093 ATGTCTATATTTAGTAGAGATGG + Intronic
1186044244 X:5517534-5517556 ATTTCTTTATTTAAGAGACAAGG + Intergenic
1186917710 X:14241750-14241772 ATGCCTTTATATAATATATATGG + Intergenic
1187138046 X:16567361-16567383 ACCTTTTTATTTAAGAGAGATGG - Intergenic
1187145304 X:16631510-16631532 ATTTCTTTATTTTAGAGACAGGG - Intronic
1187203078 X:17154658-17154680 ATGGTTTGATAAAAGAGAGATGG + Intergenic
1187337026 X:18390365-18390387 TTGTATTTTTATAAGAGACAGGG + Intergenic
1189041888 X:37550721-37550743 GTGTGTATATATGAGAGAGAGGG - Intronic
1189683683 X:43542154-43542176 ATGCCTTTATATGAGGGAGAGGG - Intergenic
1189809602 X:44768938-44768960 TTGTATTTTTATTAGAGAGAGGG - Intergenic
1190143273 X:47866739-47866761 ATGTTTATATATCAAAGAGATGG + Intronic
1192572457 X:72217965-72217987 TTTTCTTTAAATAATAGAGATGG + Intronic
1192827188 X:74709575-74709597 ATGTATTTATTTTAGAGACAAGG + Intergenic
1193168628 X:78310696-78310718 AAGGCTTTATGAAAGAGAGAAGG + Intronic
1193575293 X:83187739-83187761 ATGTATTTTTAGTAGAGAGAGGG + Intergenic
1193619452 X:83733553-83733575 ATATTTTTATATAAAAAAGAGGG + Intergenic
1194510615 X:94789972-94789994 ATGTCTGTAAATAAGAGGGATGG - Intergenic
1196254345 X:113498444-113498466 ATGTCCTTATAAAAGAGATCTGG + Intergenic
1196464109 X:115956018-115956040 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1196506868 X:116456619-116456641 ATGACTTTATAAAAAATAGATGG - Intronic
1196522040 X:116685838-116685860 ATGACTTTATACAAAATAGATGG - Intergenic
1196883122 X:120217933-120217955 AAGTCTTTATTTAAGAGATAGGG - Intergenic
1197215500 X:123862913-123862935 TTGTATTTTTATTAGAGAGAGGG - Intronic
1197437248 X:126446440-126446462 ATGTCTTCAGAAAACAGAGATGG - Intergenic
1197897306 X:131328822-131328844 AGGTCATGATATAAGAGTGAGGG + Intronic
1198280524 X:135137795-135137817 ATGTCATTTTTTAATAGAGATGG - Intergenic
1198290435 X:135234719-135234741 ATGTCATTTTTTAATAGAGATGG + Intergenic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1199582907 X:149378151-149378173 CTGTCTTCATATAATGGAGAGGG - Intergenic
1200897934 Y:8395626-8395648 TTGGCTTTATATATGTGAGAGGG + Intergenic
1201919363 Y:19217841-19217863 ATGTGTCTATATATGTGAGATGG + Intergenic