ID: 1033056571

View in Genome Browser
Species Human (GRCh38)
Location 7:138060232-138060254
Sequence TGGGGGTCACACCACCCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 203}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033056571_1033056577 -4 Left 1033056571 7:138060232-138060254 CCCTGAGGGTGGTGTGACCCCCA 0: 1
1: 0
2: 1
3: 12
4: 203
Right 1033056577 7:138060251-138060273 CCCATATATGATTTTCTTTAGGG 0: 5
1: 2
2: 3
3: 24
4: 299
1033056571_1033056579 0 Left 1033056571 7:138060232-138060254 CCCTGAGGGTGGTGTGACCCCCA 0: 1
1: 0
2: 1
3: 12
4: 203
Right 1033056579 7:138060255-138060277 TATATGATTTTCTTTAGGGATGG No data
1033056571_1033056580 11 Left 1033056571 7:138060232-138060254 CCCTGAGGGTGGTGTGACCCCCA 0: 1
1: 0
2: 1
3: 12
4: 203
Right 1033056580 7:138060266-138060288 CTTTAGGGATGGTTTAGAAATGG 0: 2
1: 3
2: 9
3: 38
4: 422
1033056571_1033056575 -5 Left 1033056571 7:138060232-138060254 CCCTGAGGGTGGTGTGACCCCCA 0: 1
1: 0
2: 1
3: 12
4: 203
Right 1033056575 7:138060250-138060272 CCCCATATATGATTTTCTTTAGG 0: 2
1: 0
2: 2
3: 17
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033056571 Original CRISPR TGGGGGTCACACCACCCTCA GGG (reversed) Intronic
900018518 1:170898-170920 GGGGGCTCACACCTCCCTAAGGG - Intergenic
900018731 1:172058-172080 AGGGGCTCACACCTCCCTAAGGG - Intergenic
900048776 1:529493-529515 GGGGGCTCACACCTCCCTAAGGG - Intergenic
900048989 1:530653-530675 AGGGGCTCACACCTCCCTAAGGG - Intergenic
900071007 1:771317-771339 GGGGGCTCACACCTCCCTAAGGG - Intergenic
900071220 1:772477-772499 AGGGGCTCACACCTCCCTAAGGG - Intergenic
901365495 1:8744370-8744392 TGAGGGTCACACTAACCACAGGG + Intronic
902636514 1:17738304-17738326 TGTGGGTGACACCACCCACCAGG - Intergenic
904345562 1:29866488-29866510 TGGGGGCCTCACCAGACTCATGG + Intergenic
904882499 1:33711633-33711655 CGAGGCTCACAGCACCCTCATGG + Intronic
905237150 1:36558066-36558088 TGGGGGACACACCATCAACAGGG - Intergenic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
906997046 1:50807512-50807534 TGGGGGTAAATCCACCCCCATGG + Intronic
907337033 1:53706548-53706570 AGGGGGTGACTCCACCTTCAAGG + Intronic
908418286 1:63934374-63934396 TGCTGGTGACACCAACCTCATGG + Intronic
911070630 1:93829314-93829336 TGGGTGTCACAGCAGCCTCCAGG - Intronic
912800774 1:112718730-112718752 TGGGGGCCACAAGACCTTCAGGG + Intergenic
914334954 1:146705892-146705914 TGAGGGTGAGACCAGCCTCACGG - Intergenic
914404563 1:147358101-147358123 TGGTGGTCGCCCCTCCCTCAGGG - Intergenic
914993433 1:152517816-152517838 TGGAGGTACCACCACCATCAGGG - Intronic
915217927 1:154352352-154352374 TTGGGGCCTCACCAGCCTCAAGG - Intergenic
915383894 1:155471396-155471418 TTTGGGTCACCCCAACCTCAAGG + Intronic
916341806 1:163745105-163745127 AGGGGATCCCACCACCCTGAAGG - Intergenic
919485192 1:198137401-198137423 TGGGAGTCACATCACCCAAAGGG - Intergenic
920362184 1:205426722-205426744 TGGGGGCCTAAACACCCTCAGGG - Intronic
921238731 1:213154638-213154660 TGGGGAACCCACTACCCTCAAGG - Intronic
922106371 1:222516767-222516789 GGGGGCTCACACCTCCCTAAGGG - Intergenic
922106581 1:222517926-222517948 AGGGGCTCACACCTCCCTAAGGG - Intergenic
924348551 1:243094332-243094354 GGGGGCTCACACCTCCCTAAGGG - Intergenic
924348765 1:243095492-243095514 AGGGGCTCACACCTCCCTAAGGG - Intergenic
924586008 1:245361907-245361929 TGGGGAAGTCACCACCCTCAAGG - Intronic
1062843056 10:686233-686255 TGGAGGCCTCCCCACCCTCATGG + Intronic
1063203334 10:3806996-3807018 TGGAGGAAGCACCACCCTCAGGG + Intergenic
1066142898 10:32525999-32526021 GGGGGAACACACCACCCTGAAGG - Intronic
1066727808 10:38410569-38410591 GGGGGCTCACACCTCCCTAAGGG + Intergenic
1067718902 10:48711707-48711729 GAGGTGACACACCACCCTCATGG + Intronic
1070696001 10:78563550-78563572 TGGGCCTCCCACCTCCCTCACGG + Intergenic
1070825277 10:79387087-79387109 TGGGGGTCAATCAACACTCATGG - Intronic
1072733179 10:97861805-97861827 TGGGGGTCACCCCGCCCTAAAGG - Intronic
1074843157 10:117374987-117375009 TGGGGGTCGCGCCGCCCTCAGGG + Exonic
1075513102 10:123088041-123088063 TGGGGCCCCCACTACCCTCAGGG + Intergenic
1076975123 11:166094-166116 GGGGGCTCACACCTCCCTAAGGG - Intergenic
1076975333 11:167254-167276 AGGGGCTCACACCTCCCTAAGGG - Intergenic
1077507084 11:2934771-2934793 TGGAGGTGACACCAGCCTGATGG - Intergenic
1080305813 11:30834065-30834087 TGGGGGTGATACCGCCCTCAAGG + Intronic
1081695496 11:45106367-45106389 CATGGGTCCCACCACCCTCAGGG + Intronic
1081789707 11:45774299-45774321 TAGGGGTCTCTCCACCCTCCAGG + Intergenic
1084004225 11:66314731-66314753 TGGGGTGCAGACCCCCCTCATGG - Exonic
1084182897 11:67455486-67455508 TGGGAGTCACAACCCCCGCAGGG - Exonic
1084713605 11:70859707-70859729 TGGAGGTCAAACCACATTCAAGG - Intronic
1085297089 11:75437413-75437435 TGGGGCACACACCAATCTCAGGG + Intronic
1085482556 11:76834846-76834868 TGGGGGGCGCTCCACTCTCATGG - Intergenic
1091646683 12:2277564-2277586 TGGGGTCCACCCCACCCTGAAGG + Intronic
1092477010 12:8828183-8828205 TGGGGAACTCACCACCCTGAAGG - Intronic
1092510938 12:9155916-9155938 ATGGAGTCACACCATCCTCATGG + Intronic
1093652056 12:21657436-21657458 TGGCGGCCACATCACCCCCACGG - Intronic
1096498497 12:52051904-52051926 TGGGGGTCACAGCACCGTGGGGG + Intronic
1096842800 12:54389771-54389793 TGGGGGTCACTCTAGCATCAGGG + Intronic
1102507318 12:113391916-113391938 TGGAGGGAACCCCACCCTCAGGG - Intergenic
1104832724 12:131765092-131765114 CTGGGGACACACCACCTTCAAGG - Intronic
1105546262 13:21352991-21353013 GGGGGTTCATACCACCCTCAAGG + Intergenic
1107934986 13:45338701-45338723 ATGGGGTCACACCATCCTCACGG + Exonic
1108922614 13:55694040-55694062 TAGGGGTCTCACCACCATGAAGG + Intergenic
1109961566 13:69638788-69638810 AGGGGATCTCACCACACTCAAGG - Intergenic
1112978037 13:105345371-105345393 TGGGGCACACATCACCCTAATGG + Intergenic
1113791241 13:113029594-113029616 CCGGGGACACAGCACCCTCAGGG - Intronic
1116141021 14:40994728-40994750 GGGGGATCTCACCACCCTGAAGG - Intergenic
1118793862 14:69121735-69121757 TGGTGCTCACACCAACCTCTTGG - Intronic
1122891164 14:104732913-104732935 TGGGGGTCACAGCACCCTCCTGG - Intronic
1126553039 15:49953719-49953741 TGGTGGTCACCCCTCCCTCGGGG + Intronic
1132712661 16:1276446-1276468 GGGGGGCCACAACACCCCCAGGG - Intergenic
1132798746 16:1741184-1741206 CAGGGGTCACGCCACCCTCGGGG - Intronic
1132939424 16:2499564-2499586 TGGGGCTCATCCCACACTCAGGG + Intronic
1134127768 16:11628234-11628256 CTGGGGCCACACCAACCTCAGGG - Intronic
1134173019 16:11983870-11983892 TGGGGGTGATATCACCCCCAAGG + Intronic
1134406101 16:13960005-13960027 TCCGGGCCACTCCACCCTCATGG - Intergenic
1134434546 16:14243951-14243973 TCGGGTTCACACCACCTCCAGGG + Intronic
1136504405 16:30693740-30693762 TGGGGGTTACAGAACCATCAAGG - Intergenic
1136717286 16:32290604-32290626 TGGGGGACACAGCTGCCTCAGGG + Intergenic
1136835661 16:33496858-33496880 TGGGGGACACAGCTGCCTCAGGG + Intergenic
1137293131 16:47065862-47065884 TGGGGGTGGCACCACCCTTAAGG + Intergenic
1139123052 16:64043478-64043500 GGGGGAGCTCACCACCCTCAAGG + Intergenic
1139998668 16:71005344-71005366 TGAGGGTGAGACCAGCCTCACGG + Intronic
1142444927 16:90130405-90130427 AGGGGCTCACACCTCCCTAAGGG + Intergenic
1142445140 16:90131565-90131587 GGGGGCTCACACCTCCCTAAGGG + Intergenic
1203009143 16_KI270728v1_random:227174-227196 TGGGGGACACAGCTGCCTCAGGG - Intergenic
1203145840 16_KI270728v1_random:1797173-1797195 TGGGGGACACAGCTGCCTCAGGG + Intergenic
1142462584 17:105061-105083 AGGGGCTCACACCTCCCTAAGGG - Intergenic
1142961416 17:3554548-3554570 TGGGGAGCACAGCACACTCAGGG - Intronic
1145067019 17:19768523-19768545 TGCTGGCCACACCAGCCTCAGGG + Intergenic
1147722139 17:42545927-42545949 TTGGGGTTACATCACCCTCCAGG + Intergenic
1148857594 17:50587234-50587256 TGGAGGTCACATCACCCTCCTGG - Intronic
1148894667 17:50832857-50832879 TAGGGCCCACACCACCCACAGGG + Intergenic
1150583248 17:66494520-66494542 GGGGGGTCACTCCACCATGAGGG - Intronic
1152306866 17:79526207-79526229 TGAGAGTCACACTCCCCTCATGG - Intergenic
1152366718 17:79860631-79860653 TGGGGGTCATGCCATCTTCAGGG + Intergenic
1152624755 17:81383128-81383150 TGGGGGTCTGTCCTCCCTCATGG - Intergenic
1157720060 18:49916691-49916713 TGAGGGTGTCCCCACCCTCACGG - Intronic
1159666945 18:71173198-71173220 TGGGCATTACACCATCCTCAAGG + Intergenic
1160652075 19:236277-236299 GGGGGCTCACACCTCCCTAAGGG - Intergenic
1160652290 19:237437-237459 AGGGGCTCACACCTCCCTAAGGG - Intergenic
1161851464 19:6739941-6739963 TGGGAGTCTCAGCACGCTCAGGG + Intronic
1163807882 19:19411034-19411056 GGGGGATGACACCACCCTCATGG + Intronic
1168121845 19:54256136-54256158 TGGGGGTCACGGGACCCACAGGG + Exonic
1168129889 19:54311507-54311529 TGGGGGTCACAGGGCCCACAGGG + Exonic
1168704498 19:58461744-58461766 TGGGTGTCCCACCAGCATCAGGG + Intergenic
925024535 2:597292-597314 CTGGGGACACACCACCATCAAGG + Intergenic
925220317 2:2134189-2134211 TGGGAGTCTCACCTCCCTCCTGG + Intronic
927500819 2:23581970-23581992 TGGAGGACAAACTACCCTCAAGG - Intronic
930210554 2:48632895-48632917 ACAGGGTCACACCATCCTCATGG + Intronic
930960848 2:57259863-57259885 TGGTGGTGACAGCACCCTTAAGG + Intergenic
931969031 2:67565800-67565822 TGGTGGTCTCCCCTCCCTCAGGG - Intergenic
932131669 2:69193084-69193106 TGGGGGGCACTCAAACCTCAGGG + Intronic
933284230 2:80367146-80367168 TTGGGGTCCCACTACCCTAAAGG - Intronic
933763992 2:85694917-85694939 TGGGGCTCACACTGACCTCAAGG - Intronic
937230753 2:120396865-120396887 TGTGGGTCCAACCACCCTCAGGG - Intergenic
939415277 2:141888090-141888112 TGAGAGTCATTCCACCCTCATGG - Intronic
947637744 2:231688680-231688702 GGGGGGTCTCCCCTCCCTCAGGG + Intergenic
1168893615 20:1309409-1309431 CAGGGGTCACAACACCCGCACGG + Intergenic
1169289547 20:4337251-4337273 TGGGGGTGACACGATCCCCAGGG + Intergenic
1169424352 20:5484758-5484780 TGGGGGTCACACTTGCTTCATGG + Intergenic
1170934028 20:20794448-20794470 TGAGTGTCTCACCACCCACATGG - Intergenic
1172604979 20:36208034-36208056 AGAGGGTCACACAACCCCCATGG + Intronic
1174093309 20:48067158-48067180 TGGGGGTCACATGTGCCTCAGGG + Intergenic
1176209884 20:63914183-63914205 TGTGGGTCACAGCACCTCCACGG - Intronic
1177771392 21:25519777-25519799 TGGGGAACTCACCACCCTAAAGG + Intergenic
1180161892 21:46001852-46001874 TGGGGGCCATGCCACCCTCTGGG + Intronic
1181629034 22:24140838-24140860 TAGGGGAGACACCACACTCAGGG - Intronic
1182151026 22:28027258-28027280 TGGGGCTCACACCAAGGTCAGGG + Intronic
1182452436 22:30429432-30429454 TGGGGCTGACACCACCATCTTGG - Intergenic
1183089670 22:35513026-35513048 TGGGGATTACATCATCCTCATGG + Intergenic
1183442230 22:37829862-37829884 GGGGGCTCACACCTCCCTAAGGG + Intergenic
1183596459 22:38815461-38815483 TGGGGGGAACAGCAGCCTCATGG + Intergenic
1184088509 22:42280282-42280304 TGGTGGTCACAACTCGCTCAAGG + Intronic
1185403885 22:50634179-50634201 TGGGTCTCCCACCAGCCTCAGGG + Intergenic
949829175 3:8196396-8196418 GGGGGATCTCACCACCCTAAAGG - Intergenic
950192195 3:10985092-10985114 TGTGGGTCACTCCAGCCCCATGG + Intergenic
952217797 3:31295129-31295151 TGGAGCCCCCACCACCCTCATGG + Intergenic
953068510 3:39497200-39497222 TGTAGGTCACACTTCCCTCAGGG + Intronic
953187732 3:40654081-40654103 TGGGGGTTACTCAACCCACAAGG + Intergenic
954447931 3:50556723-50556745 TGGTGACCACACCAGCCTCAAGG + Intergenic
956667785 3:71658402-71658424 TGTGAGTCACAGCACCCACAAGG + Intergenic
959328669 3:104973233-104973255 GGGGGATCTCACCACCCTGAAGG - Intergenic
963113840 3:141709048-141709070 ACGGGGTCACACCATCCTCACGG + Intergenic
965391290 3:168107575-168107597 TGGTGTTCACACTACTCTCAAGG - Intergenic
966454812 3:180102611-180102633 TGGTGGTCACCCCTCCCTCCAGG - Intergenic
968365544 3:198182535-198182557 AGGGGCTCACACCTCCCTAAGGG + Intergenic
968365756 3:198183695-198183717 GGGGGCTCACACCTCCCTAAGGG + Intergenic
968620429 4:1601350-1601372 TTCCGGACACACCACCCTCAAGG + Intergenic
969695900 4:8734711-8734733 TGGGAGTCACTCCACCTTCCTGG - Intergenic
971374994 4:26049528-26049550 TGGGGTTCCCACCAGCCTCGAGG + Intergenic
979254581 4:118597702-118597724 AGGGGCTCACACCTCCCTAAGGG + Intergenic
979254792 4:118598849-118598871 GGGGGCTCACACCTCCCTAAGGG + Intergenic
979334170 4:119447169-119447191 GGGGGCTCACACCTCCCTAAGGG - Intergenic
979334384 4:119448329-119448351 AGGGGCTCACACCTCCCTAAGGG - Intergenic
990016038 5:51063790-51063812 TGGCTGCCACACCTCCCTCAAGG - Intergenic
990946795 5:61257546-61257568 TGAAATTCACACCACCCTCAAGG - Intergenic
999434456 5:151552626-151552648 TGGGGGTCACAGAACCCTTCAGG - Intronic
1001860676 5:175052001-175052023 TAGGGGACACACTACCATCAGGG + Intergenic
1002500332 5:179643706-179643728 TGGGGGTCACGACAACCTCCTGG + Intronic
1002660234 5:180786745-180786767 TGGGGGTTCCTCCACCGTCAGGG - Intergenic
1002724983 5:181288915-181288937 GGGGGCTCACACCTCCCTAAGGG + Intergenic
1003438864 6:6121586-6121608 TGGGGCCCACACCAGCCCCATGG - Intergenic
1004077789 6:12361083-12361105 TAGGGGTCAGACCAACATCATGG - Intergenic
1004520131 6:16354057-16354079 TGCCGGTCACACCACACTCCAGG + Intronic
1006518188 6:34556099-34556121 TGGGGGCCTGGCCACCCTCAAGG + Exonic
1009353392 6:62709333-62709355 TGGGGGGCCCACTACCCTGAAGG - Intergenic
1010343294 6:74782002-74782024 GGGGGGACTCACCACCCTGAAGG + Intergenic
1013461469 6:110378710-110378732 TGCTGGTCACTCCTCCCTCAGGG - Intergenic
1013799054 6:113919539-113919561 TGAAGGTGACACCACTCTCAAGG + Intergenic
1016452775 6:144200491-144200513 ATGGGGTCACACCATCTTCACGG + Intergenic
1017132534 6:151120090-151120112 GGGTAATCACACCACCCTCATGG - Intergenic
1017880489 6:158559686-158559708 TTGGGGTCACAAGACCCTTAGGG + Intronic
1018927366 6:168215585-168215607 TGGGGGTCTCACCCCACACAGGG - Intergenic
1019593767 7:1848845-1848867 TGGGGGGCACACAATCCTCTGGG - Exonic
1024069673 7:45775368-45775390 AGGGGCTCACACCTCCCTAAGGG + Intergenic
1024069883 7:45776528-45776550 GGGGGCTCACACCTCCCTAAGGG + Intergenic
1025835177 7:65086693-65086715 GGGGGCTCACACCTCCCTAAGGG + Intergenic
1025904949 7:65776172-65776194 GGGGGCTCACACCTCCCTAAGGG + Intergenic
1027592348 7:80133536-80133558 TGGGAGTCACACCACCTGCTGGG - Intergenic
1029219080 7:98973813-98973835 TGGGCGGCACACCAGGCTCAGGG - Intronic
1032047059 7:128619653-128619675 AGGGGCTCACACCTCCCTAAGGG + Intergenic
1032047279 7:128620814-128620836 GGGGGCTCACACCTCCCTAAGGG + Intergenic
1033056571 7:138060232-138060254 TGGGGGTCACACCACCCTCAGGG - Intronic
1034699744 7:153085572-153085594 AGGGGTTCACACCACCCAGAAGG - Intergenic
1035456871 7:159014432-159014454 TTGTGGTCACGCCAACCTCAGGG + Intergenic
1035633678 8:1127485-1127507 TGGGAGCCACAGCACCCTCCGGG - Intergenic
1045652609 8:104355192-104355214 TGGAGGTTACACCACCATCTTGG - Intronic
1048927111 8:139281125-139281147 TTTGGGTCACTCCATCCTCATGG - Intergenic
1049368721 8:142253399-142253421 CGGGGGTGACTGCACCCTCAGGG - Intronic
1049765679 8:144354225-144354247 AGGGGCTCACACCTCTCTCAGGG + Exonic
1050221916 9:3400810-3400832 TGGGGATAACACCTCCATCAGGG - Intronic
1050660709 9:7880064-7880086 TGGCTGTCACACCTCCCCCAAGG - Intronic
1050723045 9:8612730-8612752 GGGTGGTCCCACCAGCCTCAGGG - Intronic
1053617236 9:39781217-39781239 TGGGGCTCCCACCAGCTTCATGG - Intergenic
1053875418 9:42540582-42540604 TGGGGCTCCCACCAGCTTCATGG - Intergenic
1053897224 9:42754053-42754075 TGGGGCTCCCACCAGCTTCATGG + Intergenic
1054236282 9:62561142-62561164 TGGGGCTCCCACCAGCTTCATGG + Intergenic
1054266930 9:62926220-62926242 TGGGGCTCCCACCAGCTTCATGG + Intergenic
1054550423 9:66595674-66595696 TGGGGCTCCCACCAGCTTCATGG + Intergenic
1055872086 9:80893157-80893179 TGGTTGTCACATCACCCTGAAGG - Intergenic
1060730423 9:126033588-126033610 TGGGGTTCAGAACACCCTCCAGG + Intergenic
1061822407 9:133235858-133235880 TGAGGGTAACAGCAACCTCATGG - Intergenic
1062375808 9:136261424-136261446 TGGGTGTCAGCCCACCCTCCTGG - Intergenic
1062749912 9:138245402-138245424 AGGGGCTCACACCTCCCTAAGGG + Intergenic
1062750125 9:138246562-138246584 GGGGGCTCACACCTCCCTAAGGG + Intergenic
1186515812 X:10165429-10165451 AGAGGGGAACACCACCCTCAGGG - Intronic
1186885595 X:13910123-13910145 GGGGAGCCACACCACCCTCCAGG - Intronic
1186911595 X:14173772-14173794 GGGGGATCTCACCACCCTAAAGG - Intergenic
1189277496 X:39797458-39797480 TAGGGGTCACCCCTCCCTTATGG + Intergenic
1190324593 X:49199167-49199189 TGGGGCTCACACCATCCCCAAGG - Intronic
1193243046 X:79195223-79195245 GGGGGATCTCACCACCCTGAAGG + Intergenic
1193366174 X:80637002-80637024 TGGGGGACTCACCACCCTGAAGG - Intergenic
1195079741 X:101359395-101359417 TGGAGGTTACAGCACCCTCCAGG + Intronic
1195095162 X:101494373-101494395 TGGGGATAACACCAGCATCAAGG + Exonic
1196871264 X:120115694-120115716 CGTGGTTCACACCGCCCTCAGGG + Exonic
1200060226 X:153480739-153480761 TGGGGGTGACTCCTTCCTCAGGG - Intronic