ID: 1033057338

View in Genome Browser
Species Human (GRCh38)
Location 7:138070246-138070268
Sequence CAGATAGACCTGACTTTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033057332_1033057338 12 Left 1033057332 7:138070211-138070233 CCTATTTCTAAATATAAGGTCAC 0: 1
1: 1
2: 3
3: 23
4: 264
Right 1033057338 7:138070246-138070268 CAGATAGACCTGACTTTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033057338 Original CRISPR CAGATAGACCTGACTTTGGG GGG Intronic
No off target data available for this crispr