ID: 1033059865

View in Genome Browser
Species Human (GRCh38)
Location 7:138095878-138095900
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 2, 1: 3, 2: 12, 3: 45, 4: 289}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033059865_1033059867 2 Left 1033059865 7:138095878-138095900 CCTTCTCAGTCTGTTTTGTGCTG 0: 2
1: 3
2: 12
3: 45
4: 289
Right 1033059867 7:138095903-138095925 ATAAAAGCATGCCTGAGGCCTGG No data
1033059865_1033059866 -3 Left 1033059865 7:138095878-138095900 CCTTCTCAGTCTGTTTTGTGCTG 0: 2
1: 3
2: 12
3: 45
4: 289
Right 1033059866 7:138095898-138095920 CTGCTATAAAAGCATGCCTGAGG No data
1033059865_1033059868 10 Left 1033059865 7:138095878-138095900 CCTTCTCAGTCTGTTTTGTGCTG 0: 2
1: 3
2: 12
3: 45
4: 289
Right 1033059868 7:138095911-138095933 ATGCCTGAGGCCTGGTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033059865 Original CRISPR CAGCACAAAACAGACTGAGA AGG (reversed) Intronic
902531774 1:17095234-17095256 AAGTACAAAACAGAATGTGATGG + Intronic
903310083 1:22448625-22448647 CAGGAGGAAACAGACTTAGAGGG - Intergenic
904864435 1:33566857-33566879 CAGAATAAAACAGATTGAGTGGG + Intronic
905550631 1:38835457-38835479 CATCACCAAACAGGCTGAAAAGG + Intergenic
905694615 1:39965509-39965531 CAGCACCGAGCAGACTGAGCGGG + Exonic
906731702 1:48087714-48087736 CAAAACAAAACAGAAAGAGAGGG - Intergenic
906749786 1:48248525-48248547 CAGCACTGATCACACTGAGATGG + Exonic
907106014 1:51883486-51883508 ACTCACAAAAGAGACTGAGAAGG + Intergenic
909155779 1:72074202-72074224 GAGGAAAAAACAGACTGAAAGGG + Intronic
909527580 1:76644067-76644089 CAAGAGAAAACAGACTAAGAGGG - Intergenic
910434345 1:87190153-87190175 CAGCAGCAAACAGACTGCGGAGG - Intergenic
911070651 1:93829471-93829493 TAACAGAAAGCAGACTGAGAAGG - Intronic
911347689 1:96717264-96717286 CAGCTCTAAACATACTGATAAGG + Intergenic
911350989 1:96755201-96755223 CAGCACAAAAGATACACAGATGG + Intronic
912664943 1:111570546-111570568 CAGCACAAAATGGACTAAGAGGG - Intronic
914006441 1:143736367-143736389 CAGCCCAAAAGCGACTGAGCAGG - Intergenic
914477381 1:148035137-148035159 CAGCAAAACACAGACTAACAAGG - Intergenic
916998988 1:170334639-170334661 GAGCAAGAAACAGAGTGAGACGG - Intergenic
918485284 1:185022296-185022318 CAGCACAAAACAGACCAAGATGG - Intergenic
919698235 1:200602132-200602154 AAGCACAAAACAAACTAATAGGG + Intronic
919837035 1:201582168-201582190 CACCACAAATGAGACTGAGAAGG + Intergenic
919885150 1:201928224-201928246 CAGCACAAAATGGACTAAGACGG + Intronic
920145020 1:203852654-203852676 CCACAAAAAAGAGACTGAGAGGG + Exonic
920214653 1:204353507-204353529 CAGCAGAGAAGTGACTGAGAAGG + Intronic
920516233 1:206586371-206586393 CAGCAGATAACAGGCTGAGAAGG + Intronic
920710969 1:208294660-208294682 CAGTACAAGACAGAATAAGATGG + Intergenic
920998699 1:211019993-211020015 CAGCACAAGAAATACTAAGAGGG + Intronic
922408894 1:225349308-225349330 ATGCACAAAACAAACTGAGAAGG + Intronic
923871187 1:237995746-237995768 GATGACAAAACAGACTGAGGTGG - Intergenic
924071212 1:240281451-240281473 CAGCATAAACCAGACAGACACGG - Intronic
924429068 1:243980915-243980937 CAACAGAAAACAGACTAAGACGG + Intergenic
924726181 1:246673239-246673261 CAGCACAAAACAGACTAAGATGG + Intergenic
1066170941 10:32844791-32844813 CATCACAAAACAGAATTTGAAGG - Intronic
1067661099 10:48236666-48236688 CAGCAGAAAACAGGCCAAGATGG + Intronic
1068044156 10:51863804-51863826 GAGCACAAAATGGACTAAGATGG + Intronic
1068327848 10:55518096-55518118 CAGCAGTTAACAGACTAAGATGG + Intronic
1071079867 10:81798266-81798288 CAGCAGAAAACAGGCTAATAAGG + Intergenic
1071262374 10:83932406-83932428 GAGAACAAAGCAGGCTGAGACGG + Intergenic
1071451505 10:85795899-85795921 AGGAAGAAAACAGACTGAGATGG + Intronic
1073098611 10:100995686-100995708 CAGCACAAACCAGAATGATGAGG + Intergenic
1074136511 10:110631906-110631928 CAACAAAAAACAAACTAAGAGGG + Intergenic
1074252164 10:111761903-111761925 AAGCACAAAACATAATGAGTTGG + Intergenic
1074423440 10:113329726-113329748 GAGAACAGAACAGTCTGAGAAGG + Intergenic
1076258190 10:129045204-129045226 CAGGGCTACACAGACTGAGAGGG + Intergenic
1078140657 11:8690302-8690324 CAACACAAAATGGACTAAGATGG + Intronic
1078701685 11:13691000-13691022 CAGCACAAAACAGACACAAATGG - Intronic
1078889003 11:15536929-15536951 CAGCACCAAAGATACTGAGAAGG - Intergenic
1078985942 11:16597619-16597641 CAAAACAAAACAGATTGAGATGG + Intronic
1079186211 11:18239700-18239722 TACAGCAAAACAGACTGAGAAGG - Intronic
1079653786 11:22963665-22963687 AAGAACAAAAGAGACTAAGAAGG - Intergenic
1079675039 11:23216770-23216792 CAGCTCAGAAGACACTGAGAAGG + Intergenic
1079715160 11:23734297-23734319 AAGCACAAAAAAGACAAAGAAGG + Intergenic
1079737194 11:24012154-24012176 CAGCAGAAGACAGAATGAGGAGG + Intergenic
1079819217 11:25104731-25104753 CAGCAGGAGACAGACTGTGAAGG + Intergenic
1080395404 11:31885576-31885598 TAGCACAAAACAGGCTGTGTGGG - Intronic
1080637618 11:34137766-34137788 CAGCACATACAAGACTGAGAAGG + Intronic
1082129385 11:48470513-48470535 CAGCAGAAGACAGACTGTAAAGG - Intergenic
1082186632 11:49190225-49190247 CCTCACAAAACAAACTGTGAGGG + Intronic
1084711340 11:70845770-70845792 CAGCACAGAACAAAGCGAGAAGG + Intronic
1086679706 11:89655148-89655170 CCTCACAAAACAAACTGTGAGGG - Intergenic
1088064447 11:105698977-105698999 CAGCACAGACCAGACTGACATGG - Intronic
1092146227 12:6216493-6216515 CAGCAGATAACAGAGAGAGAGGG - Intronic
1093228810 12:16517562-16517584 CAGCACAAAACAGAGACAGCAGG + Intronic
1094556021 12:31501069-31501091 CAACAGAAAAAAGACTGATATGG + Intronic
1095358719 12:41309207-41309229 AAACACAAAACTGACTGAGACGG - Intronic
1095523951 12:43102890-43102912 CAACACAAAATGGACTAAGACGG + Intergenic
1097133642 12:56833530-56833552 AAGCACAACATGGACTGAGAAGG - Intergenic
1098340869 12:69449703-69449725 TAGCACAAAATGGACTAAGATGG + Intergenic
1099027739 12:77486816-77486838 CAGCAGAAGAGAGACTGTGAGGG - Intergenic
1099065825 12:77977248-77977270 CTGTACAAAAGAGAATGAGAGGG + Intronic
1100673026 12:96836526-96836548 CAGCACCAAAGAGGCTGAGGTGG + Intronic
1100701075 12:97149183-97149205 CAGTACAACATAGACTGAAAGGG - Intergenic
1101438343 12:104683277-104683299 CACCCCAAAACAGAGAGAGAGGG + Intronic
1101510437 12:105388105-105388127 CAGCAAAAAAGTGAATGAGAGGG + Intronic
1101977813 12:109377172-109377194 CAACACAAAATGGACTAAGACGG - Intronic
1105509333 13:21038117-21038139 CAAAACAAATCAGACTGAGGAGG + Intronic
1105782393 13:23716084-23716106 CTCCACAACACAGAGTGAGAGGG - Intergenic
1107442506 13:40440692-40440714 GAGCAGAAAACAGCCTGGGATGG - Intergenic
1107877527 13:44803898-44803920 CTGCACAAAATGGACTAAGATGG - Intergenic
1108429239 13:50337526-50337548 CAGCACAAATCAGAATAAAAGGG - Intronic
1111032773 13:82627247-82627269 CAGCACAAAGCAAACTGAGGTGG - Intergenic
1112307488 13:98288209-98288231 TAGCACAATAAAGACTGAGGAGG + Intronic
1112836228 13:103517063-103517085 CAGCACACAACAAATTAAGAGGG + Intergenic
1113352366 13:109541932-109541954 AAGCACAAAACAGAAGGGGATGG + Intergenic
1113396872 13:109956060-109956082 CAGCACAAAACAGATTAAGATGG - Intergenic
1114584556 14:23798459-23798481 CAGTACAAGATAGACTAAGACGG + Intergenic
1115297804 14:31849490-31849512 CTCCAAAATACAGACTGAGATGG - Intronic
1116001332 14:39245554-39245576 CAGCACAACATTGACTAAGAGGG - Intronic
1116500534 14:45616132-45616154 CAGCACAAAATGGACTAAAACGG - Intergenic
1120388583 14:83876975-83876997 GAACACAAAACAGAATCAGAAGG + Intergenic
1120551981 14:85884009-85884031 CTGATGAAAACAGACTGAGAAGG - Intergenic
1120672237 14:87375788-87375810 CATCACAAAACAAAATGATAAGG - Intergenic
1121017099 14:90555513-90555535 CAGCAGAATCCAGACTGTGAAGG - Intronic
1122311047 14:100794622-100794644 CAACATAAAACATACAGAGAGGG + Intergenic
1122615214 14:103012949-103012971 CAGCACGTCACAGACTCAGATGG - Intronic
1125192000 15:37004387-37004409 AAGCACAAAACAGCCTGAGCAGG + Intronic
1126627303 15:50697251-50697273 CAGCACATGGGAGACTGAGACGG + Intergenic
1126673130 15:51134664-51134686 CAGCCAAGAACAGAGTGAGAGGG - Intergenic
1126869239 15:52969966-52969988 CAGCAGAAACCTGAATGAGAAGG + Intergenic
1127273430 15:57421670-57421692 CAGCAGGAAACACCCTGAGAAGG + Intronic
1128037951 15:64543229-64543251 CAACAAAAAACAGACTGGGATGG - Intronic
1128236223 15:66069202-66069224 CAGGACCAAACAGACTTGGACGG - Intronic
1128242155 15:66108487-66108509 CAAAACAAAACAGGCTAAGAGGG + Intronic
1128412468 15:67413414-67413436 CAGCAGAAACCAGACTGTAAAGG + Intronic
1128856917 15:71025766-71025788 CAGATCAAAAAAGACAGAGAAGG + Intronic
1128857265 15:71029778-71029800 CAGGTCAAAAAAGACAGAGAAGG - Intronic
1128969718 15:72097622-72097644 CAGAAAAAGAAAGACTGAGATGG + Intronic
1129138113 15:73572551-73572573 CAACACAGAACATACTGATAAGG - Intronic
1129138126 15:73572631-73572653 CAACACAGAACATACTGATAAGG - Intronic
1129667135 15:77585480-77585502 CAGGATAGAACAGACTGGGAGGG - Intergenic
1132638282 16:964646-964668 CAGAACAAAACCAACTGAGCAGG + Intronic
1132728383 16:1348641-1348663 CAGCACACACCAGACAGACACGG - Exonic
1132780790 16:1624003-1624025 CAGCCCAAAACACACTGGCATGG - Intronic
1133485596 16:6215390-6215412 CAGAAGAAAACAGGCAGAGAGGG + Intronic
1134194027 16:12144691-12144713 CAGCACAAAACAGACTGAGACGG + Intronic
1135892122 16:26366658-26366680 CAGCCCAAAGCAGAGGGAGAGGG + Intergenic
1136869264 16:33790281-33790303 CAGCAGAAATCATAATGAGAGGG + Intergenic
1138837170 16:60451887-60451909 CAGCACAAAGCAGAATAACATGG + Intergenic
1139835835 16:69837876-69837898 CAGCCCAAAAAAGTCTCAGAAGG + Intronic
1140901721 16:79373895-79373917 CAACATAAAATAGACTAAGATGG + Intergenic
1140945070 16:79760441-79760463 CAGCAGGAAACAAACTGAAAAGG - Intergenic
1203102909 16_KI270728v1_random:1325787-1325809 CAGCAGAAATCATAATGAGAGGG - Intergenic
1143113854 17:4569743-4569765 TTGCCCAAAACAGACTGAGAAGG - Intergenic
1144234320 17:13242507-13242529 TAGCACAAAACAAACTTATAGGG - Intergenic
1144355154 17:14438252-14438274 CAACAGAAAACTGACTCAGAAGG - Intergenic
1144711973 17:17407145-17407167 CAGGAAGAAACAGACTGGGAGGG + Intergenic
1145813268 17:27777684-27777706 CAGCAGCAAACAGACAGACAAGG + Intronic
1146316438 17:31810861-31810883 CAGCACAAAATGGAATGAGAGGG - Intergenic
1146394692 17:32454979-32455001 CAGTACAAAACATGCTAAGAAGG - Intronic
1148819610 17:50353038-50353060 CAGATCAAGACAGAGTGAGAGGG - Intronic
1148889201 17:50795618-50795640 TGGCACAAAGGAGACTGAGAAGG + Intergenic
1150439173 17:65177508-65177530 CAGCACCTAACATAGTGAGATGG - Intronic
1152266662 17:79298913-79298935 CAGCAGCAAACAGACTGTGCTGG + Intronic
1153243189 18:3049635-3049657 CAGCACAAAGCAAATTGTGAAGG + Intergenic
1154033876 18:10779557-10779579 CAGCACAAAAGGCACTGAGATGG - Intronic
1154050646 18:10953671-10953693 CTGCCCTAAACAGAATGAGATGG + Intronic
1156694273 18:39748100-39748122 CAACACAAAACAGACTAAGAGGG + Intergenic
1157014198 18:43690296-43690318 CAGCAGAAAACAAACTGAAATGG + Intergenic
1157196296 18:45622825-45622847 TAGCAGAAAGCAGACTGAGCTGG + Intronic
1157221176 18:45829319-45829341 CAGCACAAACCAGACCCTGAAGG - Intronic
1157272572 18:46287866-46287888 AAACACAAAGTAGACTGAGAAGG - Intergenic
1157413253 18:47481539-47481561 CAACATAAAAGAGACTGGGAAGG - Intergenic
1159398792 18:67902303-67902325 GAGAACAAACCAGACAGAGAAGG + Intergenic
1160069534 18:75613850-75613872 AAACACAAAACAGACTCAGATGG - Intergenic
1162598350 19:11647039-11647061 GAACATAAAACAGACTAAGATGG - Intergenic
1163540396 19:17905713-17905735 CAAAACAAAACAGACTTTGACGG - Intergenic
1164386771 19:27778022-27778044 CAGCAAAAAACAGATGAAGAAGG - Intergenic
1164509249 19:28884016-28884038 CAACACAAAACAGACTCATGTGG - Intergenic
1165963620 19:39555908-39555930 CAGCACAATATGGACTTAGATGG + Intergenic
1165964020 19:39559431-39559453 CAGCACAACGTAGACTGAGGTGG + Intergenic
1167028617 19:46941084-46941106 CAGCATAAAACAGAAAGAAAGGG - Intronic
1167908008 19:52678056-52678078 CAAAACAAAACAGACCCAGATGG + Intronic
925043157 2:749596-749618 AGGAACAAAACAGAATGAGATGG + Intergenic
925583069 2:5433871-5433893 CAGCATGAAACAAAATGAGAAGG - Intergenic
927105081 2:19817288-19817310 CAGCCCAAACCTGACAGAGATGG + Intergenic
927249370 2:20983969-20983991 CAGCATGGAGCAGACTGAGAGGG - Intergenic
927597717 2:24411802-24411824 CAGCACAAAATGGACTAAGACGG + Intergenic
929222977 2:39484502-39484524 CAACACAAAATGGACTAAGATGG + Intergenic
929982697 2:46696809-46696831 CAGCCCAAATCAGAATGAAAAGG - Intergenic
931151533 2:59579737-59579759 CAGCACCAAGCAATCTGAGAGGG - Intergenic
932165019 2:69498110-69498132 CAGCACCACTCAGGCTGAGAAGG - Intronic
933165158 2:79067469-79067491 AAACACAAAACAGACAAAGACGG + Intergenic
933655519 2:84883646-84883668 CAGCACAAAATGGACTAATATGG - Intronic
933655617 2:84884566-84884588 CAGCACAAAATGGACTAATATGG + Intronic
934526536 2:95055670-95055692 AAGCACAAAACAGCCAGATAGGG - Intergenic
935304759 2:101726786-101726808 CAACAGAAAAAGGACTGAGAGGG - Intronic
935332408 2:101986652-101986674 TAACACAATACACACTGAGAAGG + Intergenic
936645482 2:114364913-114364935 AAGTACATAGCAGACTGAGAAGG + Intergenic
938373877 2:130791519-130791541 CAGCAAACAGCACACTGAGAGGG + Intergenic
938754842 2:134370284-134370306 AAGAACAAAACAGAATGACAAGG - Intronic
939344312 2:140943344-140943366 CAGCATTAGACAGACTGTGAAGG + Intronic
940427177 2:153543226-153543248 GACCACAAAGGAGACTGAGAAGG + Intergenic
941006351 2:160251157-160251179 AAGCACAGAACAGACTAAGACGG + Intronic
941507343 2:166363541-166363563 CAGAACAAAACAAAATGAAATGG + Intronic
941914747 2:170803886-170803908 GTGCACATAATAGACTGAGAAGG + Intergenic
942592336 2:177559325-177559347 CAACACAAAATAGACTAAGACGG + Intergenic
942604009 2:177671459-177671481 CAGCAGAAAACATTCTGAAAGGG + Intronic
942981643 2:182091161-182091183 GAGCACAAAGGAGACTGAGAAGG + Intronic
944164397 2:196702756-196702778 CAACAGAAAACAGACTAGGACGG - Intronic
945206557 2:207338933-207338955 CAGCTCAAAACAGACAAAGCTGG - Intergenic
946066427 2:216991390-216991412 TAACACAAAACAGACTGCGAGGG + Intergenic
946881585 2:224182242-224182264 CTGCTAAAAAGAGACTGAGAAGG + Intergenic
947158057 2:227183660-227183682 CACCAGAAAACAGAGTGACATGG + Intronic
947815454 2:233033682-233033704 CAGTACAAGACAGAATGTGACGG - Intronic
947970745 2:234321587-234321609 AAGAAGAAAACAGACAGAGAAGG - Intergenic
948704070 2:239778535-239778557 CGGCACAAAGCAGGCTGTGATGG + Intronic
948954400 2:241275572-241275594 CATCCCAAAAAAGACAGAGAAGG + Intronic
1170013465 20:11754087-11754109 CAGCAAAAAAGAGAGAGAGAGGG + Intergenic
1171153551 20:22849842-22849864 CAGCAATAGACAGACTCAGAAGG + Intergenic
1171437814 20:25136666-25136688 CAGCACAAAGCAGACTAACAGGG + Intergenic
1171462614 20:25307421-25307443 GATCACAAACCAGAGTGAGAAGG + Intronic
1172324152 20:34021271-34021293 CAGCACAAAATGGACTAAGACGG - Intronic
1173182147 20:40813553-40813575 CAGTACAATGCAGGCTGAGAGGG + Intergenic
1173275955 20:41582539-41582561 TAGAACAATAGAGACTGAGATGG - Intronic
1174006820 20:47417482-47417504 CAGCACAACACTGCCAGAGAGGG + Intergenic
1175547925 20:59791385-59791407 CAGCATGAAACAAACTAAGATGG + Intronic
1177581297 21:23025158-23025180 AACCACAAAAGAGACAGAGATGG + Intergenic
1178299463 21:31439911-31439933 TAGAACAAACCAGACTGAGATGG + Intronic
1180907246 22:19423028-19423050 CAGCACCAGACAGAGGGAGAAGG - Intronic
1182393130 22:30016012-30016034 GAGAACAAGGCAGACTGAGATGG - Intronic
1184365272 22:44047102-44047124 CAACACGAAATAGACTAAGACGG - Intronic
1184447373 22:44556956-44556978 CAGAACAAAAAAGACACAGAGGG - Intergenic
1185209433 22:49561276-49561298 CAGAACAAAACAGACTAAGACGG + Intronic
949819435 3:8100106-8100128 CAGCCCATAACAAACGGAGAGGG - Intergenic
949938821 3:9137730-9137752 CAGCAGAAAGCAGAATGGGAGGG + Intronic
950095076 3:10324318-10324340 CATTACAAAACAGACTTAGGGGG + Exonic
950851614 3:16067574-16067596 CAGCACAAAACAGACTAAACAGG + Intergenic
952045095 3:29309533-29309555 CAGCACAAACAAGATTAAGAGGG + Intronic
952079920 3:29745521-29745543 CAGCAAAAATCACATTGAGAGGG + Intronic
952087123 3:29837540-29837562 CAGCTCAATACAGACGGGGAGGG - Intronic
952475705 3:33708056-33708078 CACCACAAAACAGATGGGGAAGG - Intronic
952780888 3:37097218-37097240 CAGCACAAAAGAGTATGAGTAGG + Intronic
955554845 3:60125963-60125985 CAGCACAGAACAGAGAAAGAAGG - Intronic
956004754 3:64766532-64766554 CACCAACAAAAAGACTGAGAAGG - Intergenic
956984572 3:74683907-74683929 CAACACAAAACCAACTAAGACGG - Intergenic
957423439 3:80003022-80003044 CAGCACAGAACAGACAAAGATGG + Intergenic
957817260 3:85317432-85317454 CAGCACAAAACAGACCGAAATGG - Intronic
958997243 3:100918632-100918654 CAGCACATAACAAGCAGAGATGG + Intronic
959365375 3:105451568-105451590 CAAAACAAAACAGACTTTGAGGG + Intronic
960849842 3:122041523-122041545 CAGCACAAAACAGACTAAGATGG + Intergenic
960988812 3:123297291-123297313 CAGCACAGAGCAGACAGGGAGGG - Intronic
961397601 3:126607078-126607100 CATCATTAAACAGACTGTGATGG + Intronic
964704580 3:159604222-159604244 CAGCACAGAAAAGACAAAGATGG - Intronic
966221703 3:177557816-177557838 CAGCACAAAACAAATTAAGGCGG + Intergenic
966393579 3:179477938-179477960 CAACACAAAACAGACTAAGAAGG - Intergenic
970408314 4:15784537-15784559 CAGCACACAAGAGACTATGAGGG + Intronic
970536177 4:17031744-17031766 CAGCAAAAAACATTCAGAGAGGG + Intergenic
971175777 4:24281213-24281235 CAACACAAAACAGACTAAGACGG - Intergenic
973172980 4:47167943-47167965 CAACACAAAATGGACTAAGATGG + Intronic
973605615 4:52584344-52584366 CAGCACAAAATGGACTAAGACGG + Intergenic
974158977 4:58112687-58112709 CAACAGAAAACAGTCTAAGACGG - Intergenic
977773360 4:100886461-100886483 CAGCAAAAAAAGGACTAAGAGGG - Intergenic
978085862 4:104653249-104653271 CAGCACAAAATAGACTGAAATGG - Intergenic
978735451 4:112078967-112078989 CAGTAGAACACAGACTGATAAGG + Intergenic
979572039 4:122238767-122238789 CAGGACAATGGAGACTGAGAAGG - Intronic
979610094 4:122680864-122680886 CAGCAGAAGAGAGATTGAGAGGG - Intergenic
980085585 4:128387095-128387117 CAGCAGAGAACAGACTGGGAAGG - Intergenic
981403894 4:144344367-144344389 TAGCACAAAACAGACAAAGATGG - Intergenic
982775903 4:159441112-159441134 CAACACAAAACAGACTAACGTGG + Intergenic
982807262 4:159781959-159781981 CAGGACAGAGAAGACTGAGAGGG - Intergenic
983195386 4:164800587-164800609 GACCCCAGAACAGACTGAGATGG + Intergenic
984215584 4:176909819-176909841 CAACACTAAACAGACTAAAATGG + Intergenic
984696792 4:182787269-182787291 ATGGACAAAACAGACTCAGAGGG + Intronic
984780070 4:183517451-183517473 CAACACACAACAAACTAAGAGGG - Intergenic
985298175 4:188457689-188457711 AAGGAGAAAACAGAGTGAGAGGG + Intergenic
987009648 5:13749005-13749027 CTGCACCACCCAGACTGAGAAGG + Intronic
987448893 5:18056649-18056671 CACCAAAAAACATTCTGAGAAGG + Intergenic
987984378 5:25127279-25127301 CAGCAGAAAACAGGCTGAGATGG - Intergenic
988132871 5:27128206-27128228 CAGAACAAAAGTGACTGAAATGG - Intergenic
991100889 5:62791359-62791381 CAGCATAAAATGGACTAAGATGG + Intergenic
992770217 5:80040704-80040726 CAACACAAAATGGACTGAGATGG - Intronic
993974994 5:94468508-94468530 AAGCAGCAAACAGAATGAGAAGG - Intronic
994409775 5:99392436-99392458 CAACATAAAACAGAAGGAGAGGG - Intergenic
994484045 5:100372844-100372866 CAACATAAAACAGAAGGAGAGGG + Intergenic
995097971 5:108262010-108262032 CAGCAAAATACAGAATGAAAAGG + Intronic
995740324 5:115349183-115349205 CATCACAAAATAAACTCAGAGGG - Intergenic
995998720 5:118332562-118332584 GAGCAGTCAACAGACTGAGAAGG + Intergenic
998128647 5:139640143-139640165 CAGCCCAAAACCGACCTAGAGGG - Intergenic
999278831 5:150350999-150351021 CACCAGAGAACAGACTGGGATGG + Intergenic
999549785 5:152673844-152673866 CAGAACAGAACAGCATGAGATGG + Intergenic
1000407235 5:160901107-160901129 CACCACAAGCCAAACTGAGAAGG + Intergenic
1001299148 5:170521474-170521496 CAGCACACAAAAGACTGAAATGG - Intronic
1003795367 6:9596750-9596772 CAGCACAAAATACCCTGGGAAGG - Intronic
1003855449 6:10269030-10269052 CAGCACATCACAGCCAGAGAAGG + Intergenic
1004735636 6:18403671-18403693 CAACACAAAATGGACTAAGACGG - Intronic
1007943404 6:45803303-45803325 GAGGAGAATACAGACTGAGATGG - Intergenic
1007957367 6:45929904-45929926 GAGCACAAGGCAGAATGAGAAGG + Intronic
1008042946 6:46821196-46821218 CAGAATATAAGAGACTGAGAAGG - Intronic
1009565350 6:65305211-65305233 CCACAAAAAAGAGACTGAGAGGG + Intronic
1009844516 6:69119528-69119550 CAGCATAACACTCACTGAGATGG + Intronic
1009947385 6:70355730-70355752 CTGCAGAAAACAGACTGCTATGG + Intergenic
1009990118 6:70832534-70832556 CAGCACAAAACAAACTGAGATGG - Intronic
1011227335 6:85122066-85122088 CAGCATAAAATAGACTAACATGG + Intergenic
1012280739 6:97325506-97325528 TTGCAGATAACAGACTGAGATGG + Intergenic
1013319992 6:108978752-108978774 CAGAACAAAAGAGACAAAGAAGG - Intergenic
1017378915 6:153804465-153804487 AAGCACAAAAGAGACTCAGGTGG + Intergenic
1018003985 6:159603293-159603315 CAGCACAAATCGGACTAAGCCGG - Intergenic
1019119547 6:169792351-169792373 GAGCTCACAACAGATTGAGAAGG + Intergenic
1022546084 7:31190663-31190685 CAGCAAAAAGCAGACTGTGGGGG - Intergenic
1023215579 7:37859144-37859166 CAACACAAAACAGACTAATCGGG + Intronic
1023749936 7:43362737-43362759 GAGCACACAACAGGCAGAGAAGG + Intronic
1024478446 7:49839070-49839092 CATCACAAAAAAGACAGGGAGGG - Intronic
1024715466 7:52074951-52074973 GAGCATGAAACAGCCTGAGAAGG + Intergenic
1026125997 7:67580057-67580079 CAACAGAAAACAGACTAAGATGG - Intergenic
1027434083 7:78145760-78145782 CAGCACAAAGTGGACTAAGATGG + Intronic
1028627726 7:92896489-92896511 CAGATCAAAAGAGACTAAGAAGG - Intergenic
1029163031 7:98566361-98566383 CAGCACAAAATGGACTAAGTCGG + Intergenic
1030413106 7:109206583-109206605 TAGCACAACACACACTGAAATGG + Intergenic
1030495948 7:110300758-110300780 TAACACAAAACAGACTAAGACGG - Intergenic
1030934031 7:115562359-115562381 CAGAACAAAGGAGAATGAGATGG - Intergenic
1031105732 7:117540246-117540268 CAGAACAATGCAGAATGAGATGG - Exonic
1033059865 7:138095878-138095900 CAGCACAAAACAGACTGAGAAGG - Intronic
1033363702 7:140655777-140655799 CAGCACAACAGAACCTGAGAGGG + Intronic
1033726901 7:144128648-144128670 CTGCACATCTCAGACTGAGAAGG + Intergenic
1033738000 7:144243863-144243885 CAACACAAAATGGACTTAGACGG + Intergenic
1033745055 7:144307094-144307116 CAACACAAAATGGACTTAGACGG - Intergenic
1034005824 7:147470955-147470977 CAGCAAAAGACAGACTGAGAAGG + Intronic
1035306974 7:157939656-157939678 CAGCACCAGACAGACAGAGTTGG + Intronic
1035814089 8:2520017-2520039 CAGCACAGAACAGATTCACACGG - Intergenic
1036286639 8:7448841-7448863 CAGCACAAAACAGGCTGTCTGGG - Intronic
1036334838 8:7862683-7862705 CAGCACAAAACAGGCTGTCTGGG + Intronic
1037502699 8:19500769-19500791 CAGCACACAATGGACTAAGAGGG - Intronic
1038126778 8:24682825-24682847 CATCACAAAAAAACCTGAGATGG + Intergenic
1038707857 8:29911813-29911835 CAGAACAGAAGAGAATGAGATGG + Intergenic
1039069529 8:33636837-33636859 CAACAGAAGCCAGACTGAGAAGG + Intergenic
1039155587 8:34552980-34553002 CAGCCCAAAACAGAGTGAAAAGG - Intergenic
1039377503 8:37050706-37050728 CAGCACAAAATGGACTAAGACGG - Intergenic
1039386886 8:37143848-37143870 CTGCAGAAAACAGACTGGGATGG + Intergenic
1039570559 8:38582930-38582952 CAGCAAAACACAAACAGAGAAGG + Intergenic
1040823502 8:51591266-51591288 CAGCAGAAAATTGACTAAGACGG + Intronic
1040975443 8:53189014-53189036 TAGCAAAAAAGAGACTTAGACGG + Intergenic
1041592228 8:59601479-59601501 CACCTCAAAACAGAATAAGAAGG - Intergenic
1041683777 8:60623428-60623450 CAGGACTAAATAAACTGAGATGG - Exonic
1041739418 8:61142260-61142282 CAGCAAGAAAGAGACAGAGAGGG - Intronic
1041819082 8:62009325-62009347 AACTACAAATCAGACTGAGAAGG + Intergenic
1042188724 8:66164264-66164286 AAGCACAACAAAGACTGGGACGG + Intronic
1042264950 8:66899127-66899149 CTCCAGAACACAGACTGAGATGG + Intronic
1042569072 8:70142926-70142948 AAACAAAACACAGACTGAGAGGG - Intronic
1042676770 8:71330022-71330044 CAGCAAAAAACACACTGTGTGGG + Intronic
1042776974 8:72442926-72442948 CTGGACATAACAGAATGAGAAGG - Intergenic
1043558274 8:81459842-81459864 CATCACAAAGAAGAGTGAGATGG + Intronic
1046123829 8:109879619-109879641 CATCCCAAAAGAAACTGAGAAGG + Intergenic
1050756667 9:9012632-9012654 GAGAACAAAACAGACTTTGAAGG + Intronic
1052298450 9:26925864-26925886 CAGCACCATATAGACTGAGCTGG + Exonic
1052672817 9:31580088-31580110 CACCAACAGACAGACTGAGATGG - Intergenic
1053029432 9:34761661-34761683 CAGCACAAAAGAGTATGAGTAGG - Intergenic
1053179658 9:35957796-35957818 CTGCACAGCACAGGCTGAGAAGG + Exonic
1053450592 9:38191243-38191265 AAACACAAAACAGACTAGGATGG - Intergenic
1055171513 9:73265076-73265098 CAACACTAAACAAACTAAGATGG + Intergenic
1056210785 9:84363256-84363278 GAGCTTAAAAGAGACTGAGAAGG + Intergenic
1057016549 9:91657531-91657553 CAGGACCAAACAGCCTGAGTTGG - Intronic
1057194044 9:93106759-93106781 TAACACAAAAGAAACTGAGAAGG - Intronic
1058605723 9:106720461-106720483 CAGCACACAGCACACTGTGATGG - Intergenic
1058673995 9:107385101-107385123 TAACAAAAAAGAGACTGAGAAGG + Intergenic
1058674414 9:107388212-107388234 CTGCAGAAAACTGAGTGAGAAGG - Intergenic
1061070089 9:128304315-128304337 CCCCACAAAGGAGACTGAGAAGG + Intergenic
1062179021 9:135180702-135180724 CAGCAGCACACAGGCTGAGAAGG + Intergenic
1186881191 X:13867838-13867860 CAGCACAGAAGAGACTGAAAAGG + Intronic
1186920306 X:14271229-14271251 CAACACAAAACAGACTAAGATGG + Intergenic
1187711207 X:22056389-22056411 CATGACCAAACAGACTTAGAAGG - Intronic
1187948036 X:24445601-24445623 CAGCAGAAAACAGACAAAGACGG - Intergenic
1189529909 X:41869258-41869280 CAGAACAAAACAGAATAAGGTGG - Intronic
1191815398 X:65239328-65239350 GAGAACAAAAAAGACAGAGAAGG - Intergenic
1192256768 X:69467915-69467937 CAACACAAAATAGATTAAGACGG + Intergenic
1196164428 X:112522911-112522933 CAACACAAAACAGACTAAGAAGG - Intergenic
1196292448 X:113959310-113959332 CAGCACAAAACAGATATAGTAGG + Intergenic
1196789058 X:119447778-119447800 CCCCACAAAGAAGACTGAGAAGG - Intronic
1197316513 X:124972883-124972905 CAACACAAAACAAACTAAGATGG - Intergenic
1197342777 X:125293294-125293316 CAACACAAAATAGACTAAGACGG - Intergenic
1199416183 X:147585725-147585747 CAGGAAAAAACAGACTGATTTGG + Intergenic
1199549157 X:149039785-149039807 CAGCACAAAATGAACTGAGATGG - Intergenic