ID: 1033060827

View in Genome Browser
Species Human (GRCh38)
Location 7:138105357-138105379
Sequence CAATTTTAACCGCAGGCAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 49}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033060823_1033060827 -10 Left 1033060823 7:138105344-138105366 CCCTGGGAGTGTCCAATTTTAAC 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1033060827 7:138105357-138105379 CAATTTTAACCGCAGGCAGCTGG 0: 1
1: 0
2: 1
3: 5
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033060827 Original CRISPR CAATTTTAACCGCAGGCAGC TGG Exonic
900866927 1:5275541-5275563 CAATATTAACTCCAGGAAGCCGG + Intergenic
902652480 1:17845558-17845580 CCCTTTTTACAGCAGGCAGCAGG - Intergenic
916563143 1:165950146-165950168 CAATTTTGAATTCAGGCAGCTGG + Intergenic
918588298 1:186212829-186212851 CAATTATAACTGCAGGTAGCAGG + Intergenic
920287657 1:204892088-204892110 CAATTTTAATCACAGGAAGGTGG + Intronic
922384934 1:225073247-225073269 CACTTTTACCCCCAGTCAGCTGG + Intronic
1063304557 10:4885448-4885470 CAACTTCAACCGCAGGCAACTGG - Intergenic
1063312626 10:4968872-4968894 CAACTTCAACCGCAGGCAGCTGG + Exonic
1063315309 10:4998675-4998697 CAACTTCAACCACAGGCTGCTGG - Exonic
1063325679 10:5099377-5099399 AAACTTCAACCGCAGGCAGCTGG + Exonic
1063335243 10:5206325-5206347 AAACTTCAACTGCAGGCAGCTGG + Exonic
1066570210 10:36763102-36763124 GCATTTTAAGCGTAGGCAGCTGG - Intergenic
1074529672 10:114288648-114288670 CAATTTCAAACTCATGCAGCTGG - Intronic
1075432401 10:122399096-122399118 CAATTTAAACTTCAGGAAGCAGG - Intronic
1076265427 10:129106024-129106046 AAATTTTAACCCCAGGCATATGG + Intergenic
1077248278 11:1549486-1549508 CAATTATCCCTGCAGGCAGCTGG - Intergenic
1079345368 11:19647099-19647121 CAATCTTGACCACAGGCACCAGG - Intronic
1097886648 12:64735580-64735602 CAGTTTTTTCCACAGGCAGCTGG + Intronic
1099931245 12:89077514-89077536 TTATTTTAAAAGCAGGCAGCAGG + Intergenic
1110185001 13:72663686-72663708 TAATTTCAACTGGAGGCAGCAGG + Intergenic
1125445170 15:39746491-39746513 CAATTTTAAAAGCATGCAGATGG + Intronic
1128705548 15:69835238-69835260 CCCTTTTAACCGCAGCCAGAAGG - Intergenic
1129594406 15:76950268-76950290 CAATTTTAACCTAATTCAGCAGG + Intronic
1133030208 16:3007203-3007225 CAATATAAAGCGCAGGGAGCTGG - Intergenic
1134539778 16:15055498-15055520 CAACGTTCACCGCAGGCTGCGGG + Intronic
1148836702 17:50469352-50469374 CCCTTTAAAGCGCAGGCAGCTGG - Intronic
1153952136 18:10066875-10066897 CAGTTTTATCAGCATGCAGCTGG - Intergenic
1157609836 18:48949510-48949532 AATTTTTAACCGCAGACTGCAGG + Intronic
1162536925 19:11268120-11268142 CCATTTTCACCACAGGCACCAGG - Intergenic
1163034443 19:14562982-14563004 CACTTTTACCCTCAGCCAGCAGG - Intronic
939978167 2:148745183-148745205 GGATTTTAATCGCAGGCATCAGG + Intronic
946543564 2:220712488-220712510 TAATTTTGACCCCAGGGAGCTGG - Intergenic
1170437935 20:16349660-16349682 CAATATTAACCCGAGGCAGCAGG - Intronic
1173620837 20:44434666-44434688 CAAATCTCAGCGCAGGCAGCCGG + Intergenic
1177131822 21:17267048-17267070 CAATTTTAAACTCAGAGAGCTGG + Intergenic
1181507049 22:23366268-23366290 CAATTCTTACCATAGGCAGCGGG + Intergenic
1184855892 22:47146542-47146564 CAATCTCCACCCCAGGCAGCCGG + Intronic
1185183064 22:49374066-49374088 CAGTTTTATCTGCAGGCAGAGGG + Intergenic
949099331 3:125374-125396 CAATTTTAAACACAGTAAGCAGG + Intergenic
950905982 3:16538717-16538739 CAATCACAACCACAGGCAGCAGG + Intergenic
958444884 3:94203036-94203058 CAAGTTTATCTCCAGGCAGCTGG + Intergenic
967973899 3:195020178-195020200 CAAATTTAACAGATGGCAGCAGG - Intergenic
973539100 4:51917805-51917827 CAATTTTAACAGCGTGCACCTGG - Intergenic
979676611 4:123416212-123416234 CTAAGTCAACCGCAGGCAGCGGG + Intergenic
979990317 4:127367477-127367499 CAATTTTAAGTGCTGGCAGCAGG - Intergenic
993805375 5:92401577-92401599 CAATTTCAACTGCTGGCTGCCGG - Intergenic
998201039 5:140121453-140121475 CAATTTTAAATGCAGGTAGTTGG + Exonic
1006777488 6:36606881-36606903 AAATCTTAAGCTCAGGCAGCTGG + Intergenic
1020535283 7:9389106-9389128 CAATTCTGACCTCAGGCACCTGG + Intergenic
1025709751 7:63898292-63898314 CAATTTAAAAAGCAGGCAGTAGG + Intergenic
1030024755 7:105312594-105312616 CGATTTTATCTGCAGCCAGCAGG - Intronic
1033060827 7:138105357-138105379 CAATTTTAACCGCAGGCAGCTGG + Exonic
1045215832 8:100147359-100147381 CAATTTAAAAGGCAGACAGCAGG + Intergenic
1048022012 8:130548010-130548032 CACATTTGACTGCAGGCAGCAGG + Intergenic
1061636589 9:131914327-131914349 AAAATTTAACCTCAGTCAGCCGG - Intronic
1188981002 X:36727026-36727048 CAATTTTAAGGGGAGGCAGAGGG - Intergenic