ID: 1033063995

View in Genome Browser
Species Human (GRCh38)
Location 7:138135249-138135271
Sequence CTTCTAATGCAAAATGTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033063995_1033063997 -10 Left 1033063995 7:138135249-138135271 CCCTACACATTTTGCATTAGAAG No data
Right 1033063997 7:138135262-138135284 GCATTAGAAGTGTTGTGCTGAGG No data
1033063995_1033063998 -9 Left 1033063995 7:138135249-138135271 CCCTACACATTTTGCATTAGAAG No data
Right 1033063998 7:138135263-138135285 CATTAGAAGTGTTGTGCTGAGGG No data
1033063995_1033064000 -1 Left 1033063995 7:138135249-138135271 CCCTACACATTTTGCATTAGAAG No data
Right 1033064000 7:138135271-138135293 GTGTTGTGCTGAGGGGTATGTGG No data
1033063995_1033064003 18 Left 1033063995 7:138135249-138135271 CCCTACACATTTTGCATTAGAAG No data
Right 1033064003 7:138135290-138135312 GTGGGATTAGGAAAAACACTTGG No data
1033063995_1033063999 -8 Left 1033063995 7:138135249-138135271 CCCTACACATTTTGCATTAGAAG No data
Right 1033063999 7:138135264-138135286 ATTAGAAGTGTTGTGCTGAGGGG No data
1033063995_1033064002 6 Left 1033063995 7:138135249-138135271 CCCTACACATTTTGCATTAGAAG No data
Right 1033064002 7:138135278-138135300 GCTGAGGGGTATGTGGGATTAGG No data
1033063995_1033064001 0 Left 1033063995 7:138135249-138135271 CCCTACACATTTTGCATTAGAAG No data
Right 1033064001 7:138135272-138135294 TGTTGTGCTGAGGGGTATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033063995 Original CRISPR CTTCTAATGCAAAATGTGTA GGG (reversed) Intergenic
No off target data available for this crispr