ID: 1033064990

View in Genome Browser
Species Human (GRCh38)
Location 7:138145947-138145969
Sequence GCAACTAGACAGTTTCATCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033064986_1033064990 -5 Left 1033064986 7:138145929-138145951 CCCTGAGCTTGTGTTCCTGCAAC 0: 8
1: 684
2: 721
3: 475
4: 359
Right 1033064990 7:138145947-138145969 GCAACTAGACAGTTTCATCCGGG No data
1033064985_1033064990 18 Left 1033064985 7:138145906-138145928 CCATAATGTAGAATCAGTGGGAG 0: 498
1: 722
2: 496
3: 244
4: 220
Right 1033064990 7:138145947-138145969 GCAACTAGACAGTTTCATCCGGG No data
1033064987_1033064990 -6 Left 1033064987 7:138145930-138145952 CCTGAGCTTGTGTTCCTGCAACT 0: 10
1: 721
2: 770
3: 487
4: 399
Right 1033064990 7:138145947-138145969 GCAACTAGACAGTTTCATCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033064990 Original CRISPR GCAACTAGACAGTTTCATCC GGG Intergenic
No off target data available for this crispr