ID: 1033068526

View in Genome Browser
Species Human (GRCh38)
Location 7:138179994-138180016
Sequence GACAAGTAGGAGAAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033068526_1033068534 29 Left 1033068526 7:138179994-138180016 CCAGCCTCCTTCTCCTACTTGTC No data
Right 1033068534 7:138180046-138180068 CCCTTCAGTAGACAGAATAATGG No data
1033068526_1033068530 -1 Left 1033068526 7:138179994-138180016 CCAGCCTCCTTCTCCTACTTGTC No data
Right 1033068530 7:138180016-138180038 CTTTCAGAATAATAGTAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033068526 Original CRISPR GACAAGTAGGAGAAGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr