ID: 1033070075

View in Genome Browser
Species Human (GRCh38)
Location 7:138194011-138194033
Sequence ACAGGAACTGTTTTACCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033070068_1033070075 29 Left 1033070068 7:138193959-138193981 CCAGGGACATATTCCCTGAGAAA No data
Right 1033070075 7:138194011-138194033 ACAGGAACTGTTTTACCAGGTGG No data
1033070067_1033070075 30 Left 1033070067 7:138193958-138193980 CCCAGGGACATATTCCCTGAGAA No data
Right 1033070075 7:138194011-138194033 ACAGGAACTGTTTTACCAGGTGG No data
1033070070_1033070075 15 Left 1033070070 7:138193973-138193995 CCTGAGAAAATTATGTGCATCTG No data
Right 1033070075 7:138194011-138194033 ACAGGAACTGTTTTACCAGGTGG No data
1033070069_1033070075 16 Left 1033070069 7:138193972-138193994 CCCTGAGAAAATTATGTGCATCT No data
Right 1033070075 7:138194011-138194033 ACAGGAACTGTTTTACCAGGTGG No data
1033070073_1033070075 -10 Left 1033070073 7:138193998-138194020 CCAGGATATTTATACAGGAACTG No data
Right 1033070075 7:138194011-138194033 ACAGGAACTGTTTTACCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033070075 Original CRISPR ACAGGAACTGTTTTACCAGG TGG Intergenic
No off target data available for this crispr