ID: 1033072369

View in Genome Browser
Species Human (GRCh38)
Location 7:138215865-138215887
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 13, 1: 53, 2: 41, 3: 37, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033072367_1033072369 2 Left 1033072367 7:138215840-138215862 CCATGGAAAAAGGACCTAACAAA 0: 39
1: 40
2: 27
3: 29
4: 254
Right 1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG 0: 13
1: 53
2: 41
3: 37
4: 140
1033072366_1033072369 7 Left 1033072366 7:138215835-138215857 CCAAACCATGGAAAAAGGACCTA 0: 14
1: 15
2: 18
3: 7
4: 111
Right 1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG 0: 13
1: 53
2: 41
3: 37
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033072369 Original CRISPR ATGCCCTTCTAGAAGAGTGA AGG Intergenic
904043236 1:27596078-27596100 ATGCCCCTCTGGGAGAATGAAGG + Intronic
905159352 1:36017946-36017968 ATGCCCATCCAGAAGAGTGAAGG + Intronic
907211830 1:52830334-52830356 ATGTCCTGGTAGAAGAGTGAAGG + Intergenic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
908732635 1:67242150-67242172 ATGCCCTGCTAGAAGAGTGAAGG + Intronic
909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG + Intergenic
909576125 1:77178295-77178317 ATGCCCTTCTAGAAGTATGAAGG - Intronic
909825012 1:80116807-80116829 ATGCTCTTCTGGAAGAGTGAAGG + Intergenic
910809643 1:91223092-91223114 ATCCCCTTTTAGAAGAGTGAAGG - Intergenic
911696228 1:100893376-100893398 ATGCCCTTGGAGCAGTGTGAAGG - Intronic
913133053 1:115859989-115860011 GTGCCAGTCTAGAATAGTGAGGG - Intergenic
913261766 1:117005024-117005046 ATGCCCTTGTAAAAGAGTCCAGG - Intronic
916402952 1:164468723-164468745 ATGACCTTCTATTAGAGTGTAGG - Intergenic
916567043 1:165990026-165990048 ATGTCCTTCTATAAGTGAGAGGG + Intergenic
916640556 1:166724402-166724424 ATGCCCTTCTACAAGAGTGAAGG - Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
920433164 1:205931824-205931846 ATGCCCTTCTAGCAGGGTTGGGG + Intronic
920830758 1:209463593-209463615 ATGCCCATCTTGCTGAGTGATGG - Intergenic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922759018 1:228113558-228113580 ATGTCCTTTTAGAAAAGTGAAGG + Intergenic
922847428 1:228698653-228698675 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
1063322745 10:5066958-5066980 ATGCCCTTCTAAAAGAGTGAAGG + Intronic
1065807216 10:29405324-29405346 ATGTCCTTCTGTAAGAGTGAAGG + Intergenic
1066976426 10:42372236-42372258 ATACCCATCCAGAAGAGTGAAGG + Intergenic
1068401266 10:56530710-56530732 ATGACTTTCTTGAAGACTGAGGG + Intergenic
1071673151 10:87630367-87630389 ATGCCCATCCAAAAGAATGAAGG - Intergenic
1072779838 10:98241162-98241184 ATTCCCTTCTTTTAGAGTGACGG - Intronic
1073515012 10:104068530-104068552 TTGGCCTTCTAGAAGCTTGAGGG - Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078749248 11:14144209-14144231 ATACCCTTTTAGAAGATGGAAGG - Intronic
1081585069 11:44378638-44378660 ATGCCCTGTGAGGAGAGTGATGG - Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1083376656 11:62228828-62228850 ATACCCTTCTGGAAGTGTGAAGG - Intergenic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG + Intronic
1088103815 11:106183577-106183599 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1089524867 11:119090266-119090288 GTATCCTTTTAGAAGAGTGACGG + Intronic
1089902255 11:121999384-121999406 ATGCCTTTCAAGAAAAGAGAAGG + Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1091726373 12:2849223-2849245 AAGCCCTTCTAGAAGTGTCCAGG + Intronic
1093356236 12:18171840-18171862 ATGCCATTCTAGAAGATTGAAGG - Intronic
1094239593 12:28206886-28206908 ATGCCCTTCCAGGGAAGTGAAGG + Intronic
1094346758 12:29478586-29478608 TTTCCCTTCTAGAAGGGTTAAGG - Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1098004862 12:65985580-65985602 ATGCCTCTCTTGAAGAGTGAAGG + Intergenic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1098502563 12:71210505-71210527 GTGTCCTTCTAGAAGAATAAAGG - Intronic
1098709588 12:73738673-73738695 ATCCCCTCCTAGCAGAGTGTTGG + Intergenic
1098711973 12:73774195-73774217 ATGCCCATCCAGAAGAGTGAAGG - Intergenic
1099488830 12:83262051-83262073 AGTCCCTTCTTGAAGGGTGATGG + Intergenic
1100159163 12:91837651-91837673 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1106542950 13:30706176-30706198 ATGCCTTTCTAGGAGATTGGTGG + Intergenic
1106624385 13:31405578-31405600 ATGGACTTTTAGAAGAGTGAAGG - Intergenic
1107255476 13:38421082-38421104 CTACCCATCTAGAAGAGTGAAGG + Intergenic
1109860162 13:68187779-68187801 ATGTCATTCTAGAGGAGAGAAGG + Intergenic
1110356267 13:74571470-74571492 ATGCCCTGGTAGTAAAGTGACGG + Intergenic
1110960105 13:81610618-81610640 ATGCCCTTCTAAAAAAGTGAAGG - Intergenic
1111594602 13:90395612-90395634 ATGCCCTTCTAGAAGACTGATGG - Intergenic
1113968453 13:114168849-114168871 ATGCCCTTCCAGAAGAGTGAAGG + Intergenic
1114912219 14:27214563-27214585 ATGCTCTTCTAAAAGAGTGAAGG + Intergenic
1114919707 14:27311393-27311415 ATGCCCTTCTAGAATGCTGCAGG - Intergenic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1116234949 14:42268088-42268110 ATGCCCTTCTAGAAAAGTGAAGG + Intergenic
1116483920 14:45424040-45424062 ATGCCCTTCTAGAAGAGTAAAGG - Intergenic
1116576586 14:46583054-46583076 GATCCCTTTTAGAAGAGTGAAGG + Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1116725624 14:48558391-48558413 ATACCCTTATAGAAGAGTGAAGG + Intergenic
1118299850 14:64605675-64605697 ATGCCATTCTGGATGAATGAGGG + Intergenic
1120232149 14:81851488-81851510 ATGCCCCTTTAGAATAGTGAAGG + Intergenic
1120649792 14:87118438-87118460 ATACCACTCTAGAAGAGTGAAGG - Intergenic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1122076001 14:99234995-99235017 AAGTCCCTCTAGAAGAGAGACGG - Intronic
1123540670 15:21286541-21286563 AAGCCCTTTTATAAGAGAGATGG + Intergenic
1124373610 15:29116936-29116958 ATGCCCATCTCCTAGAGTGAAGG - Intronic
1126740890 15:51775069-51775091 GGGCCCTTCTGGAAGATTGAAGG + Intronic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1129260280 15:74362982-74363004 ATGCCCTTTCAGAAGAGTGAAGG - Intronic
1129453132 15:75661833-75661855 TTTCCCCTCTAGATGAGTGAAGG + Exonic
1132278367 15:100590470-100590492 ATGCCCTTCTAGAAGATTGAAGG - Intronic
1202948981 15_KI270727v1_random:13684-13706 AAGCCCTTTTATAAGAGAGATGG + Intergenic
1134829539 16:17312078-17312100 AAGGCCTTCTAGAAGAGTCAAGG + Intronic
1136638917 16:31545542-31545564 ATGCCCATCGACAAGCGTGAAGG + Intergenic
1136931969 16:34426792-34426814 ATGCACATCCAGAAGAGTGAAGG + Intergenic
1136972603 16:34985023-34985045 ATGCACATCCAGAAGAGTGAAGG - Intergenic
1140231847 16:73123805-73123827 ATGCCCTTATAGAAGAGGCCTGG + Intergenic
1143152723 17:4817222-4817244 CTGCCCTCCTGGAAGTGTGAAGG - Exonic
1144426679 17:15149489-15149511 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1147166575 17:38596589-38596611 ATGCCATTCTGGAAGGTTGATGG + Intronic
1147463876 17:40595142-40595164 ATGCCTATCTAGAAGAGTGAAGG - Intergenic
1153261193 18:3226005-3226027 TTGCACTTCGAGAAGAGAGATGG + Intergenic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1155590329 18:27420230-27420252 ATGCATTTCAAGAAGACTGAAGG - Intergenic
1155803424 18:30137294-30137316 ATGCCCTTTTAAAAGAATGAAGG + Intergenic
1157013303 18:43678854-43678876 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1157109714 18:44809207-44809229 TTGCCTTTATAGGAGAGTGAAGG - Intronic
1158190121 18:54818215-54818237 ATGCCCTTCCTAAAGAGTTAGGG + Intronic
1160262929 18:77312438-77312460 ATGCCTTTCTAGAAGAGTGAAGG + Intergenic
1162229779 19:9256542-9256564 ACATCCTTCTAGAATAGTGATGG - Intergenic
1163766634 19:19166764-19166786 CTGCCCTTCTGGAAGATTCAAGG - Intronic
1164138702 19:22438094-22438116 ATGCCCATTCAGAAGAGTAATGG - Intronic
1164181948 19:22827018-22827040 ATGCCCATTCAGAAGAGTAATGG - Intergenic
1164212606 19:23112892-23112914 ATGCCCATTTAGAAAAGTAATGG - Intronic
1164461337 19:28451388-28451410 ATGCCCTTTTAGAAAAGTGAAGG - Intergenic
1165327821 19:35124562-35124584 GTGCCCTTCTAGATGGGCGACGG - Exonic
1168152379 19:54456027-54456049 CTGCCCCTCTAGGAGGGTGAAGG - Exonic
926522055 2:13927706-13927728 ATGTCCATCTAGAAGAGTGAAGG - Intergenic
928256714 2:29729145-29729167 ATTACCTTCTGGAAAAGTGAAGG + Intronic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
928847087 2:35689267-35689289 ATGGTCTTCTGGAAGAGAGAGGG - Intergenic
929278449 2:40050927-40050949 ATGCCACTCTAGTAGAGGGAGGG + Intergenic
929428940 2:41870659-41870681 ATGTCCTTCAAGAAGAGTTTAGG + Intergenic
929442404 2:41974240-41974262 ATGACCAACTGGAAGAGTGAGGG + Intergenic
929823293 2:45290492-45290514 ATGACCTGCTAGATGAGAGAGGG + Intergenic
933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG + Intergenic
933736246 2:85497068-85497090 ATGCCCATTCAGAAGGGTGAAGG - Intergenic
935238812 2:101160728-101160750 ATGCCATTCTAGGAGGGGGAGGG + Intronic
936125578 2:109787009-109787031 ATGCCCTTCTGGAAAGGTGAAGG + Intergenic
936219115 2:110584459-110584481 ATGCCCTTCTGGAAAGGTGAAGG - Intergenic
937225188 2:120364722-120364744 ATGCTCTTTTTGAAGAATGACGG - Intergenic
938898427 2:135776314-135776336 ATGCTCCTCTAGAAGAGGCAAGG + Exonic
940442698 2:153736973-153736995 CTGCCCTCCCAGAAGAGTGATGG - Intergenic
940569296 2:155409914-155409936 ACGCCCTTTTAGAAGAGTGAAGG - Intergenic
943372763 2:187036275-187036297 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
944606331 2:201354818-201354840 CTGGCCTTCAAGAAGAGAGAAGG - Intronic
947004971 2:225500754-225500776 TTGACCTTCTAGCAGAGAGATGG - Intronic
1170677801 20:18498521-18498543 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1171721762 20:28570300-28570322 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171785953 20:29464694-29464716 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1172780106 20:37431531-37431553 CTGCCCTTCAAGATGGGTGATGG + Intergenic
1174961803 20:55166152-55166174 CTGCCCTTCAAGATGAGAGAAGG - Intergenic
1175078115 20:56392868-56392890 AGGCCCTTCGAGAAGAGGAAGGG - Intronic
1177326858 21:19601857-19601879 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1177411374 21:20734352-20734374 ATGGCTTTCTAGTCGAGTGAAGG + Intergenic
1177534067 21:22401693-22401715 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1177801700 21:25834490-25834512 AAGCCCTTCCAGCTGAGTGACGG + Intergenic
1180295318 22:10928987-10929009 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1181453732 22:23041413-23041435 ATGCCCATCTAGAAGAATGAAGG + Intergenic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
1185325246 22:50222350-50222372 ATGCTCTTCTAGGAGAGGGCTGG - Intronic
949962609 3:9325620-9325642 ATGTCCTTCTAGACGAGTGAAGG + Intronic
951187212 3:19727649-19727671 ATGTCCTTGTGGAAGAGTGAAGG - Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951603158 3:24399291-24399313 ATGCCCTTCAGGTAGACTGAGGG - Intronic
951841564 3:27039463-27039485 ACGCCCTTTTAGAAGAATGAAGG + Intergenic
957750863 3:84413533-84413555 ATGCCCTTCTAGAATAGTGAAGG - Intergenic
959560874 3:107779291-107779313 TTGCCCTTCAAGCACAGTGAAGG + Intronic
959776949 3:110176856-110176878 ATGCCCTTATAAAAGAGAAAGGG - Intergenic
960966087 3:123105687-123105709 GTGCCCTTCTATAATAGTAAGGG - Intronic
962185810 3:133258368-133258390 ATGCCCTTCTTGTAGCTTGATGG - Intronic
962850572 3:139305731-139305753 ATGCCTTTCTTGCAGGGTGACGG + Intronic
963226306 3:142866027-142866049 ATGCTCTTCAATAAGTGTGATGG + Intronic
963576623 3:147068406-147068428 ATGTCCTTTTAGAAGAGGGAAGG - Intergenic
963928765 3:150979581-150979603 ATGCGCATCTAGAACAGTTATGG - Intergenic
964439981 3:156698214-156698236 TTGCACTTCTATAAGAGAGATGG - Intronic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
966686402 3:182700493-182700515 ATGCCCATTCAGAAGTGTGAAGG + Intergenic
968386349 4:142529-142551 ATGCCCCTCTAGAAGAGTGAAGG - Intronic
970761851 4:19498972-19498994 ATGACCATCTGGAAGACTGAAGG - Intergenic
971643407 4:29164665-29164687 ATGCCGTACTGGAAGTGTGAAGG + Intergenic
971962857 4:33511345-33511367 ATGCCCATCCAGAAGGGTAAAGG - Intergenic
972078078 4:35111661-35111683 ATCCCATTCTAGAAGAGAGTTGG + Intergenic
972819190 4:42680004-42680026 ATGTCCTGCTAGAAGAGTGAAGG - Intergenic
974189795 4:58489830-58489852 ATGCCGTTTTAGAAGAGTGAAGG + Intergenic
974550296 4:63363394-63363416 CTGCTCTTCTAGATGAGTTATGG + Intergenic
974649357 4:64734193-64734215 ATGCCCATTTAGAATAGTAAAGG - Intergenic
975062929 4:70025727-70025749 AGGCCATTTTAGAAGACTGATGG - Intergenic
975063007 4:70026720-70026742 AGGCCATTTTAGAAGACTGATGG + Intergenic
975064850 4:70047985-70048007 AAGCCATTTTAGAAGACTGATGG - Intergenic
975140879 4:70917106-70917128 ATGCCCTTTTAGAACAGTGAAGG + Intronic
977319256 4:95490184-95490206 ATGCACTTCCAGAAGATGGAAGG + Intronic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
979296245 4:119035331-119035353 CTGCCCTCCTAGAAGACTGAGGG - Intronic
979780407 4:124644695-124644717 CAGCCCTTTTAGAAGATTGAGGG + Intergenic
980937018 4:139235247-139235269 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
981201305 4:141982806-141982828 ATATCCTTTTAGAAGATTGAAGG - Intergenic
982731723 4:158963457-158963479 ATGCCCAGCTAGTAGAGAGAGGG + Intronic
985221801 4:187714050-187714072 ATCCCCTTCAAAAATAGTGACGG + Intergenic
988103951 5:26718911-26718933 ATGCCCATCTACATAAGTGAGGG - Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
989598924 5:43183738-43183760 ATGATGTCCTAGAAGAGTGAAGG + Intronic
990082002 5:51928480-51928502 ATGCCCTTCTAGAAGATCGAAGG - Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
993248789 5:85487644-85487666 ATGCCCTTCCAGAAGAGTGAAGG - Intergenic
993946807 5:94124767-94124789 CTGCCCTTGAAGAAGAGGGATGG + Intergenic
994467662 5:100159043-100159065 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
996233423 5:121095639-121095661 ATGCCCTGCTGGAAGCATGAGGG - Intergenic
996500465 5:124210635-124210657 ATGCCATGCTTGGAGAGTGAGGG + Intergenic
996805185 5:127446711-127446733 AGGCCCTTTTAGGAAAGTGAAGG + Intronic
997572779 5:134944827-134944849 ATGCCCTTGCTGAAGAGAGAAGG + Intronic
999092658 5:148951086-148951108 AGGCCCTTCCACAAGACTGAAGG - Intronic
1001604924 5:172952756-172952778 ATTCACTTCTAGAGGAGAGAAGG + Intergenic
1003785893 6:9486677-9486699 TTGACCTTCCAGCAGAGTGAGGG + Intergenic
1004265707 6:14146679-14146701 CTGCACTTCTAGCAGAGTGTGGG - Intergenic
1005639408 6:27781807-27781829 ATGCCTTTTTAGAAGAGTGAAGG - Intergenic
1006290670 6:33133669-33133691 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1006506575 6:34492802-34492824 ATGGACTTCTAGAGGAGGGAAGG + Intronic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1008290977 6:49715770-49715792 ATGCCCTTCTAGAAAAGCAAAGG - Intergenic
1009405229 6:63304259-63304281 ATGCCCATCTAGAAAGGTGAAGG - Intronic
1009595540 6:65730525-65730547 ATCCCTTGCTAGATGAGTGATGG + Intergenic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011153247 6:84299077-84299099 GTGCCCATTCAGAAGAGTGAAGG - Intergenic
1011341867 6:86324826-86324848 AAGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011357282 6:86484989-86485011 ATACTCATCTGGAAGAGTGAAGG - Intergenic
1012096051 6:94962752-94962774 ATGCACTTCTAGAATGGTGCAGG + Intergenic
1013389307 6:109667126-109667148 AGGCCCTTTTAAAATAGTGATGG + Intronic
1013620565 6:111884280-111884302 ATGCCCTTCTACATTAGAGAGGG + Intergenic
1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG + Intronic
1014567352 6:122966073-122966095 ATCCCATACTAGAACAGTGAAGG - Intergenic
1015831327 6:137372239-137372261 ATGCCCATCTAGAATACTGAAGG + Intergenic
1016854702 6:148655577-148655599 ATGATGTCCTAGAAGAGTGAAGG - Intergenic
1017386442 6:153890225-153890247 ATGCCCACCCAGAAGGGTGAAGG - Intergenic
1019140948 6:169942041-169942063 ACGTCCTTCCAGAAAAGTGAGGG - Intergenic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1019837505 7:3403731-3403753 GTGCTCTTCTGAAAGAGTGAGGG + Intronic
1020027199 7:4907520-4907542 ATGGTCTTCTTCAAGAGTGACGG - Exonic
1020647225 7:10829519-10829541 ATGGCCTTCTAGAAGAGTGAAGG - Intergenic
1020650458 7:10868797-10868819 ATGCCCATCTGTAAAAGTGAGGG - Intergenic
1022914865 7:34938011-34938033 ATTACATTCTAGAAGAGTCATGG - Exonic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1028140771 7:87272807-87272829 CTGGCCTTGTAGAAGAGTAAAGG + Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030144456 7:106339430-106339452 CTTCTCTTATAGAAGAGTGAAGG - Intergenic
1030861048 7:114629723-114629745 ATGCCAGTCTAGAAGAGTTTAGG + Intronic
1031305387 7:120119664-120119686 ATGTCCTTCTAAAAGAATGAAGG - Intergenic
1032938331 7:136759957-136759979 GTGCCTTTCTAGAAAAGGGAGGG + Intergenic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1034375842 7:150643149-150643171 AGGCACTGCTACAAGAGTGATGG + Intergenic
1034398836 7:150848120-150848142 ATGCGCTTCTAGAGAAGTGTGGG - Intronic
1034907121 7:154959541-154959563 AGGCCATTCTTGAAGTGTGAGGG - Intronic
1038682287 8:29679812-29679834 ATTCCCTTCTTCAACAGTGAAGG - Intergenic
1038951215 8:32416438-32416460 ATGCCCTCATAGAATGGTGAGGG - Intronic
1039817969 8:41111405-41111427 ATGCCCACCTGGAAGAGTGAGGG - Intergenic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1040402721 8:47068473-47068495 ATGCCCTCCTAGAAGAGTGAAGG - Intergenic
1043137330 8:76544641-76544663 ATGCCCATCCAGAAGAGTAAAGG - Intergenic
1043827090 8:84942282-84942304 ATGTCCTTCTAAAGGAGTGAAGG - Intergenic
1046202585 8:110946858-110946880 AGGCCCTTCTAGAAGACTGAAGG + Intergenic
1046487144 8:114901550-114901572 ATACCCTTCTAGAAGAGTGAAGG - Intergenic
1047595834 8:126377060-126377082 ATTCTCCTCTAGAAAAGTGAGGG - Intergenic
1049774681 8:144398861-144398883 ATGCTCTTCTAGAATGATGATGG + Exonic
1050314545 9:4387958-4387980 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1052037469 9:23699056-23699078 ATGTCTTTCTATAGGAGTGAAGG + Intronic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056921076 9:90789652-90789674 GTGCCCTGCTAGTAGAGTCAGGG + Intergenic
1057781151 9:98051602-98051624 ATGCCCTTCTAGAGGAGTGAAGG + Intergenic
1058047265 9:100369934-100369956 ATGTCCATCCAAAAGAGTGAAGG - Intergenic
1058151393 9:101467370-101467392 ATTCCTTTCTTGAAGAGTAAAGG + Intergenic
1058218064 9:102259719-102259741 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1058312744 9:103525751-103525773 ATGCTCTTTCAGAAGAGTGATGG - Intergenic
1202802194 9_KI270720v1_random:10091-10113 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1203446753 Un_GL000219v1:63862-63884 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1186219531 X:7334620-7334642 GTGGCTTGCTAGAAGAGTGAGGG - Intronic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1187794861 X:22992873-22992895 ATGCCCTTTTTGTAGAATGATGG - Intergenic
1188803077 X:34555539-34555561 ATGCCTTTCTAGAAAAGTCAAGG - Intergenic
1189664623 X:43340546-43340568 ATGCCTATCCAGAAGGGTGAAGG - Intergenic
1192983595 X:76372700-76372722 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1193507940 X:82365611-82365633 ATGCCCTTTTAAAAAAGTGAAGG + Intergenic
1193695699 X:84705220-84705242 ATGCCAGTCCAGAATAGTGAAGG + Intergenic
1195471855 X:105239392-105239414 ATGCCTTTCTAGAAGAATGAAGG + Intronic
1195558720 X:106258133-106258155 ATGCCCGTCTAGAATAGCGAAGG + Intergenic
1196464109 X:115956018-115956040 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1196542576 X:116926451-116926473 ATGCTCTTGTAGAAGAGCAAAGG + Intergenic
1196809386 X:119616671-119616693 CTGCCATTATAGAAGAGTTAGGG - Intronic
1196967936 X:121078558-121078580 ATGCACTTTTAAAATAGTGAAGG + Intergenic
1196973469 X:121134227-121134249 AGGCCCTTTTGGAAGAGTGAAGG + Intergenic
1197243087 X:124140575-124140597 ATGCACTTTTAGAAAAGTGAAGG + Intronic
1197883876 X:131197508-131197530 ATGCCCTTCTGGAAGAATAGAGG + Intergenic
1197934465 X:131726602-131726624 ATGCCCTTTGAGAAGAGTGAAGG - Intergenic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1200407576 Y:2829125-2829147 ATGCCTTTCAGGAAGAGTGAAGG + Intergenic
1200734268 Y:6776901-6776923 TTGCCCTTTTAGAATAGTGAAGG + Intergenic