ID: 1033074949

View in Genome Browser
Species Human (GRCh38)
Location 7:138240118-138240140
Sequence CTGTGCGGCCAGAAGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033074941_1033074949 28 Left 1033074941 7:138240067-138240089 CCTCACATGGTTACCTTGGTCCA No data
Right 1033074949 7:138240118-138240140 CTGTGCGGCCAGAAGGAAGATGG No data
1033074943_1033074949 15 Left 1033074943 7:138240080-138240102 CCTTGGTCCATATCAAGGAATGA No data
Right 1033074949 7:138240118-138240140 CTGTGCGGCCAGAAGGAAGATGG No data
1033074944_1033074949 8 Left 1033074944 7:138240087-138240109 CCATATCAAGGAATGAGCAATGA No data
Right 1033074949 7:138240118-138240140 CTGTGCGGCCAGAAGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033074949 Original CRISPR CTGTGCGGCCAGAAGGAAGA TGG Intergenic
No off target data available for this crispr