ID: 1033076258

View in Genome Browser
Species Human (GRCh38)
Location 7:138253054-138253076
Sequence GGCAGCTCTTGGCCTCTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033076254_1033076258 12 Left 1033076254 7:138253019-138253041 CCTGTCTTCTGCAGATAACTACT No data
Right 1033076258 7:138253054-138253076 GGCAGCTCTTGGCCTCTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033076258 Original CRISPR GGCAGCTCTTGGCCTCTTAC TGG Intergenic
No off target data available for this crispr