ID: 1033082334

View in Genome Browser
Species Human (GRCh38)
Location 7:138310101-138310123
Sequence TATCCCTGTGGGCTTCCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033082334_1033082337 11 Left 1033082334 7:138310101-138310123 CCTCAAGGAAGCCCACAGGGATA No data
Right 1033082337 7:138310135-138310157 TTCTAGTCACCTTCTAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033082334 Original CRISPR TATCCCTGTGGGCTTCCTTG AGG (reversed) Intergenic
No off target data available for this crispr