ID: 1033094642

View in Genome Browser
Species Human (GRCh38)
Location 7:138419835-138419857
Sequence GCTTTCAGGCATACAGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033094642_1033094647 2 Left 1033094642 7:138419835-138419857 CCATCCCCTGTATGCCTGAAAGC No data
Right 1033094647 7:138419860-138419882 ATCATAAAATCCCCCCGTGAAGG No data
1033094642_1033094657 29 Left 1033094642 7:138419835-138419857 CCATCCCCTGTATGCCTGAAAGC No data
Right 1033094657 7:138419887-138419909 CCTCGGCAACTTCCCATACCAGG No data
1033094642_1033094648 3 Left 1033094642 7:138419835-138419857 CCATCCCCTGTATGCCTGAAAGC No data
Right 1033094648 7:138419861-138419883 TCATAAAATCCCCCCGTGAAGGG No data
1033094642_1033094658 30 Left 1033094642 7:138419835-138419857 CCATCCCCTGTATGCCTGAAAGC No data
Right 1033094658 7:138419888-138419910 CTCGGCAACTTCCCATACCAGGG No data
1033094642_1033094650 12 Left 1033094642 7:138419835-138419857 CCATCCCCTGTATGCCTGAAAGC No data
Right 1033094650 7:138419870-138419892 CCCCCCGTGAAGGGCACCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033094642 Original CRISPR GCTTTCAGGCATACAGGGGA TGG (reversed) Intergenic
No off target data available for this crispr