ID: 1033099767

View in Genome Browser
Species Human (GRCh38)
Location 7:138460350-138460372
Sequence CGCCTCCCGAGTGGCGCGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 536
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 500}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033099767_1033099773 -5 Left 1033099767 7:138460350-138460372 CCGGCCGCGCCACTCGGGAGGCG 0: 1
1: 0
2: 1
3: 34
4: 500
Right 1033099773 7:138460368-138460390 AGGCGGATCCCGTGGGCCTGAGG 0: 1
1: 0
2: 2
3: 23
4: 366
1033099767_1033099778 12 Left 1033099767 7:138460350-138460372 CCGGCCGCGCCACTCGGGAGGCG 0: 1
1: 0
2: 1
3: 34
4: 500
Right 1033099778 7:138460385-138460407 CTGAGGAGGCTTCCCCCGCCCGG 0: 1
1: 0
2: 1
3: 14
4: 158
1033099767_1033099774 -2 Left 1033099767 7:138460350-138460372 CCGGCCGCGCCACTCGGGAGGCG 0: 1
1: 0
2: 1
3: 34
4: 500
Right 1033099774 7:138460371-138460393 CGGATCCCGTGGGCCTGAGGAGG 0: 1
1: 0
2: 0
3: 13
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033099767 Original CRISPR CGCCTCCCGAGTGGCGCGGC CGG (reversed) Exonic
900613554 1:3554366-3554388 CCCCTCCCGCCTGGCCCGGCTGG - Intronic
901271162 1:7953280-7953302 CACCTCCCGGATGGGGCGGCTGG - Intergenic
902385451 1:16073291-16073313 CGCGTCCCCAGGGGTGCGGCGGG + Intronic
903103569 1:21053742-21053764 CACCTCCCGGATGGGGCGGCTGG - Intronic
903748503 1:25604122-25604144 CACCTCCCGGATGGGGCGGCTGG - Intergenic
903962426 1:27064944-27064966 CACCTCCCGGATGGGGCGGCTGG - Intergenic
905680886 1:39869911-39869933 CGCCTCCCGGACGGGGCGGCTGG - Intronic
906036111 1:42750968-42750990 CACCTCCCGGATGGGGCGGCTGG - Intronic
906329990 1:44876595-44876617 CACCTCCCGGATGGGGCGGCTGG - Intronic
906427508 1:45725488-45725510 CACCTCCCGGATGGGGCGGCTGG - Intronic
906761370 1:48382300-48382322 CACCTCCCGGATGGGGCGGCTGG + Intronic
906761704 1:48383048-48383070 CACCTCCCGGATGGGGCGGCTGG + Intronic
906956926 1:50381999-50382021 CACCTCCCGGATGGGGCGGCTGG - Intergenic
907188940 1:52633069-52633091 CGCGGCCAGAGTGGCGGGGCGGG - Intergenic
908370646 1:63474295-63474317 CACCTCCCGGATGGGGCGGCTGG - Intronic
909640815 1:77869537-77869559 CACCTCCCGGATGGGGCGGCTGG + Intronic
911351603 1:96762361-96762383 CACCTCCCGGATGGGGCGGCTGG + Intronic
911602015 1:99857034-99857056 CACCTCCCGGATGGGGCGGCTGG + Intronic
912660960 1:111529964-111529986 CACCTCCCGGATGGGGCGGCTGG + Intronic
913994271 1:143638996-143639018 CACCTCCCGGATGGGGCGGCTGG - Intergenic
914002267 1:143703187-143703209 CACCTCCCGGATGGGGCGGCTGG - Intergenic
914002317 1:143703313-143703335 CACCTCCCGGATGGGGCGGCTGG - Intergenic
914392285 1:147233495-147233517 CACCTCCCGGATGGGGCGGCTGG - Intronic
914888291 1:151601045-151601067 CACCTCCCGGATGGGGCGGCCGG - Intergenic
914888320 1:151601122-151601144 CACCTCCCGGATGGGGCGGCTGG - Intergenic
914893735 1:151651196-151651218 CACCTCCCGGGCGGGGCGGCTGG + Intronic
915502448 1:156328256-156328278 CACCTCCCGGATGGGGCGGCTGG - Intronic
915539827 1:156558522-156558544 CACCTCCCGGGTGGGGCGGCTGG - Intronic
917582947 1:176396345-176396367 CACCTCCCGGATGGGGCGGCTGG + Intergenic
917859956 1:179135672-179135694 CACCTCCCGGATGGGGCGGCTGG - Intronic
918022686 1:180710795-180710817 CACCTCCCGGATGGGGCGGCTGG + Intronic
918260282 1:182789656-182789678 CGCCGCCCGCGAGGCGCGCCCGG - Intronic
919080220 1:192857687-192857709 TCCCTCCCGAATGGGGCGGCTGG - Intergenic
920152256 1:203919415-203919437 CACCTCCCGGATGGGGCGGCTGG + Intergenic
920152426 1:203919816-203919838 CACCTCCCGAGTGGCTGGCCGGG + Intergenic
920451725 1:206064676-206064698 CACCTCCCGGATGGGGCGGCTGG - Intronic
921142433 1:212320777-212320799 CACCTCCCGGATGGTGCGGCTGG + Intronic
921237944 1:213151438-213151460 CACCTCCCGGATGGGGCGGCTGG + Intronic
921237996 1:213151565-213151587 CACCTCCCGGATGGGGCGGCTGG + Intronic
921638417 1:217524042-217524064 CACCTCCCGGATGGGGCGGCTGG + Intronic
921814182 1:219546104-219546126 CACCTCCCGGATGGGGCGGCTGG - Intergenic
921814245 1:219546268-219546290 CACCTCCCGGATGGGGCGGCTGG - Intergenic
922306488 1:224349811-224349833 CACCTCCCGAACGGGGCGGCTGG + Intergenic
922503729 1:226114894-226114916 CACCTCCCGGATGGGGCGGCTGG + Intergenic
922644929 1:227276472-227276494 CACCTCCCGAACGGGGCGGCTGG - Intronic
922692987 1:227710597-227710619 CACCTCCCGGATGGGGCGGCTGG + Intergenic
923468164 1:234267473-234267495 CACCTCCCGGATGGGGCGGCTGG + Intronic
924692322 1:246363320-246363342 CACCTCCCGGATGGGGCGGCTGG - Intronic
1065594239 10:27296282-27296304 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1066140475 10:32500196-32500218 CACCTCCCGGATGGGGCGGCCGG + Intronic
1066437346 10:35406824-35406846 CACCTCCCGGATGGGGCGGCTGG + Intronic
1067026587 10:42847735-42847757 CACCTCCCGGGCGGGGCGGCTGG - Intergenic
1067119877 10:43464964-43464986 CACCTCCCGGATGGGGCGGCTGG + Intronic
1067331953 10:45330675-45330697 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1067334452 10:45348539-45348561 CGCCTCCCAGGTGGGGCGGCTGG - Intergenic
1068536303 10:58244199-58244221 CACCTCCCAGGTGGGGCGGCCGG - Intronic
1068969910 10:62948492-62948514 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1069045876 10:63742493-63742515 AGCCTCCCGAGTAGAGCAGCTGG + Intergenic
1069645286 10:69992672-69992694 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1069645387 10:69992925-69992947 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1069928773 10:71869253-71869275 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1069928925 10:71869606-71869628 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1072180615 10:92976073-92976095 CACCTCCCGGGCGGGGCGGCTGG - Intronic
1072602095 10:96940910-96940932 CACCTCCCGGATGGGGCGGCTGG + Intronic
1072602124 10:96940987-96941009 CACCTCCCGGATGGGGCGGCCGG + Intronic
1072684568 10:97528863-97528885 CACCTCCCGGATGGGGCGGCTGG + Intronic
1073594320 10:104785041-104785063 CACCTCCCGGATGGGGCGGCTGG + Intronic
1074588056 10:114787427-114787449 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1076999772 11:316673-316695 CCCCTCCCGGGTGGGGCCGCAGG + Intergenic
1077201628 11:1310186-1310208 CTCCTGCGGAGCGGCGCGGCGGG - Intergenic
1077542474 11:3153777-3153799 CGACTCCCGAGTGGCCCACCAGG + Intronic
1078177210 11:8978923-8978945 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1079020675 11:16907282-16907304 CACCTCCCGGATGGGGCGGCTGG - Intronic
1079371897 11:19859961-19859983 CACCTCCCGGATGGGGCGGCTGG + Intronic
1079444998 11:20548934-20548956 CACCTCCCGGATGGGGCGGCCGG - Intergenic
1079445027 11:20549011-20549033 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1080098021 11:28430348-28430370 CTCCTCCCGGATGGCACGGCTGG - Intergenic
1081289282 11:41305303-41305325 CACCTCCCGGATGGGGCGGCTGG - Intronic
1081950163 11:47038068-47038090 CACCTCCCGGATGGGGCGGCTGG + Intronic
1081950315 11:47038420-47038442 CACCTCCCGGATGGGGCGGCTGG + Intronic
1082065258 11:47893471-47893493 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1083042335 11:59699944-59699966 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1083115121 11:60451797-60451819 CACCTCCCGGGTGGGGCGGCTGG - Intronic
1083131020 11:60622918-60622940 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1083391748 11:62356216-62356238 CACCTCCCGGATGGGGCGGCTGG + Intronic
1083611802 11:64007887-64007909 CGCCTCCAGAGGGCCGAGGCTGG + Intronic
1083646126 11:64172471-64172493 CACCTCCCGGATGGCACGGCTGG + Intergenic
1083747773 11:64745009-64745031 GGCCTCCCGGGCGGCGCGGCAGG - Intronic
1083795386 11:65013965-65013987 CGCCTCCCGAGGGCTGAGGCTGG - Intergenic
1083865613 11:65451519-65451541 CACCTCCCGGATGGTGCGGCTGG - Intergenic
1083865685 11:65451695-65451717 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1084049047 11:66588093-66588115 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1084049222 11:66588494-66588516 CACCTCCCGGATGGCGCGGCTGG - Intergenic
1084624139 11:70295149-70295171 CACCTCCTGGGTGGGGCGGCTGG + Intronic
1085292310 11:75409780-75409802 CACCTCCCGGATGGGGCGGCTGG + Intronic
1085791370 11:79500139-79500161 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1086122536 11:83316826-83316848 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1086430599 11:86732546-86732568 CACCTCCCGGGTGGGGCGGCTGG - Intergenic
1086792879 11:91063759-91063781 CGCCTCCCGGACGGGGCGGCTGG - Intergenic
1086881549 11:92157819-92157841 CACCTCCCGTATGGGGCGGCTGG - Intergenic
1092453988 12:8626169-8626191 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1092827390 12:12413674-12413696 CACCTCCCGGATGGGGCGGCTGG + Intronic
1096064026 12:48724965-48724987 CACCTCCCGGGTGGGGCGGCTGG - Intergenic
1096092982 12:48915743-48915765 CACCTCCCGGATGGGGCGGCTGG + Intronic
1096146684 12:49283580-49283602 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1096167422 12:49436699-49436721 CACCTCCCGGATGGGGCGGCTGG + Intronic
1096557086 12:52410012-52410034 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1097228584 12:57495182-57495204 CACCTCCCGGATGGGGCGGCTGG + Intronic
1097779593 12:63686987-63687009 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1098412815 12:70202412-70202434 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1098413150 12:70203161-70203183 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1098883979 12:75942385-75942407 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1100507531 12:95235634-95235656 CACCTCCCGGATGGGGCGGCTGG + Intronic
1101674269 12:106903453-106903475 CGCCTCGCGAGTGGAGCGCTAGG + Intergenic
1103591399 12:121994049-121994071 CACCTCCCGGATGGGGCGGCTGG - Intronic
1104348678 12:128025980-128026002 CACCTCCCACGTGGCGTGGCTGG - Intergenic
1105248538 13:18674106-18674128 CACCTCCCGGGCGGGGCGGCTGG - Intergenic
1105526935 13:21186311-21186333 CACCTCCCGGGCGGGGCGGCTGG + Intergenic
1106114570 13:26806264-26806286 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1106495435 13:30270321-30270343 CACCTCCCGGGTGGGGCGGCTGG - Intronic
1106560094 13:30839567-30839589 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1106680156 13:32000259-32000281 CGCCTCCCGGATGGGGCGGCTGG - Intergenic
1107493275 13:40900945-40900967 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1110269673 13:73575606-73575628 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1111418135 13:87976205-87976227 CACCTCCCTGGTGGGGCGGCTGG + Intergenic
1112556191 13:100470737-100470759 AGCCTCCCGAGTAGAGTGGCTGG - Intronic
1114427906 14:22637756-22637778 CACCTCCCGAACGGGGCGGCTGG - Intergenic
1114428031 14:22638052-22638074 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1115259304 14:31437004-31437026 CGCCTCCCGGACGGGGCGGCTGG + Intronic
1115688843 14:35824549-35824571 CACCTCCCGGGCGGGGCGGCTGG + Intergenic
1115703265 14:35976739-35976761 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1117277232 14:54203822-54203844 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1117954473 14:61111905-61111927 CACTTCCCGAGTGGCGAGGCCGG + Intergenic
1118148670 14:63165817-63165839 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1118148747 14:63165993-63166015 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1119254176 14:73183892-73183914 CACCTCCCGGGCGGGGCGGCTGG + Intronic
1119594821 14:75924878-75924900 CACCTCCCGGATGGGGCGGCTGG + Intronic
1121111795 14:91317751-91317773 GGCCTCCCGAGGGCCACGGCAGG + Intronic
1122212382 14:100181201-100181223 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1122212435 14:100181329-100181351 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1122554733 14:102571967-102571989 AGCCTCCCGAGTAGCTGGGCGGG + Intergenic
1122568059 14:102676305-102676327 CACCTCCCGGATGGGGCGGCTGG + Intronic
1123004387 14:105314449-105314471 CGGCTCCCGGGGGGCGGGGCGGG + Exonic
1202882678 14_KI270722v1_random:75449-75471 AGCCTCCCGAGTAGCTGGGCTGG - Intergenic
1124633280 15:31349372-31349394 CGCCTCCCATGTGGCCCAGCGGG - Intronic
1125016920 15:34946603-34946625 CACCTCCCGGATGGGGCGGCTGG - Intronic
1125017048 15:34946910-34946932 CACCTCCCGGATGGGGCGGCTGG - Intronic
1125459346 15:39893698-39893720 CACCTCCCGGGCGGGGCGGCTGG + Intronic
1125817813 15:42601500-42601522 CACCTCCCGGATGGGGCGGCTGG + Intronic
1125868617 15:43077051-43077073 CACCTCCCGGATGGGGCGGCTGG - Intronic
1126295827 15:47133605-47133627 CACCTCCCGGATGGGGCGGCTGG - Exonic
1127072977 15:55303057-55303079 TCCCTCCCGGATGGCGCGGCTGG - Intronic
1127154151 15:56109987-56110009 CGCCTCCCGGACGGGGCGGCTGG - Intronic
1127154353 15:56110438-56110460 CGCCTCCCGGATGGGGCGGCTGG - Intronic
1127584744 15:60367711-60367733 CACCTCCCGGATGGGGCGGCTGG - Intronic
1128454151 15:67823329-67823351 CACAGCCCGAGTGGCGGGGCAGG - Intronic
1128489814 15:68134809-68134831 CACCTCCCGGATGGGGCGGCTGG + Intronic
1128490054 15:68135333-68135355 CACCTCCCGGATGGGGCGGCTGG + Intronic
1128586863 15:68859620-68859642 CACCTCCCGGATGGGGCGGCTGG + Intronic
1128586997 15:68859924-68859946 CACCTCCCGGATGGGGCGGCTGG + Intronic
1128843678 15:70871546-70871568 CACCTCCCGAACGGCGCGGCTGG + Intronic
1131141204 15:89978151-89978173 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1132320201 15:100919625-100919647 CGCGGCCCGAGGGGCGCGGAGGG + Intronic
1134471805 16:14532724-14532746 CACCTCCCGGGAGGGGCGGCTGG + Intronic
1134854128 16:17505608-17505630 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1134995371 16:18734651-18734673 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1136160717 16:28417039-28417061 CACCTCCCGGGCGGGGCGGCTGG - Intergenic
1136165237 16:28448868-28448890 TCCCTCCCGGGTGGGGCGGCTGG - Intergenic
1136165260 16:28448917-28448939 TCCCTCCCGGGTGGGGCGGCTGG - Intergenic
1136197714 16:28666103-28666125 TCCCTCCCGGGTGGGGCGGCTGG + Intergenic
1136197737 16:28666152-28666174 TCCCTCCCGGGTGGGGCGGCTGG + Intergenic
1136202251 16:28697962-28697984 CACCTCCCGGGCGGGGCGGCTGG + Intronic
1136214052 16:28780240-28780262 TCCCTCCCGGGTGGGGCGGCTGG + Intergenic
1136214075 16:28780289-28780311 TCCCTCCCGGGTGGGGCGGCTGG + Intergenic
1136258788 16:29060164-29060186 TCCCTCCCGGGTGGGGCGGCTGG + Intergenic
1136258811 16:29060213-29060235 TCCCTCCCGGGTGGGGCGGCTGG + Intergenic
1136572169 16:31104525-31104547 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1137240739 16:46653255-46653277 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1137283981 16:47000526-47000548 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1138307355 16:55989507-55989529 CACCTCCCAGATGGCGCGGCCGG - Intergenic
1138467111 16:57200754-57200776 CACCTCCCGGATGGGGCGGCTGG + Intronic
1138642288 16:58396356-58396378 CACCTCCCGGATGGGGCGGCTGG + Intronic
1139347044 16:66310670-66310692 TGCCTCCCCAGTGTCGGGGCAGG - Intergenic
1139623109 16:68163332-68163354 CACCTCCCGGGCGGGGCGGCTGG + Intronic
1139649466 16:68355155-68355177 CACCTGCAGAGTGGCCCGGCTGG + Intronic
1139864725 16:70052348-70052370 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1140994394 16:80244031-80244053 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1141830927 16:86509807-86509829 CCCCGCCCGGGCGGCGCGGCGGG - Intergenic
1142022974 16:87795542-87795564 GGCCTCCCCAGTGGCGAGCCAGG - Intergenic
1142332434 16:89463073-89463095 CACCTCCCGGGCGGGGCGGCTGG - Intronic
1142529916 17:572435-572457 CACCTCCCGGATGGGGCGGCTGG - Intronic
1142533719 17:599024-599046 CACCTCCCGGATGGGGCGGCTGG - Intronic
1142533771 17:599151-599173 CACCTCCCGGGCGGGGCGGCTGG - Intronic
1142670588 17:1485860-1485882 CGCCTCCCGCGCGGCCGGGCTGG + Intronic
1142705006 17:1689297-1689319 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1142810083 17:2391890-2391912 GGCCTCCCGAGTAGCGTAGCTGG + Intronic
1142825477 17:2507399-2507421 CACCTCCCGGATGGGGCGGCTGG - Intronic
1142825529 17:2507526-2507548 CACCTCCCGGATGGGGCGGCTGG - Intronic
1142939558 17:3371211-3371233 CACCTCCCGGGTGGGGCGGCTGG + Intergenic
1144524622 17:15979682-15979704 TCCCTCCCGAATGGGGCGGCTGG + Intronic
1144524651 17:15979760-15979782 CACCTCCCGGATGGGGCGGCTGG + Intronic
1144606135 17:16667040-16667062 CGGACCCCGAGAGGCGCGGCGGG - Intergenic
1145684559 17:26639120-26639142 CACCTCCCGCATGGGGCGGCTGG - Intergenic
1145684608 17:26639246-26639268 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1145863168 17:28224678-28224700 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1146215835 17:30979202-30979224 CACCTCCCGGATGGGGCGGCTGG + Intronic
1146216267 17:30980175-30980197 CACCTCCCGGATGGGGCGGCTGG + Intronic
1146443998 17:32921875-32921897 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1147709116 17:42449431-42449453 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1149793728 17:59500549-59500571 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1150217004 17:63476680-63476702 CGCCTCCGGAGTGACAAGGCCGG - Intergenic
1150996007 17:70318607-70318629 AGCCTCCCGAGTGGAGTAGCTGG + Intergenic
1152020368 17:77777043-77777065 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1152396342 17:80035863-80035885 CGCCGCCAGTGAGGCGCGGCGGG + Intergenic
1152696079 17:81797741-81797763 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1154158246 18:11960066-11960088 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1154265430 18:12874706-12874728 CACCTCCCGGGTGGGGCGGCTGG - Intronic
1154278173 18:12979839-12979861 CACCTCCCGAATGGGGCGGCTGG + Intronic
1154278315 18:12980176-12980198 CACCTCCCGGATGGGGCGGCTGG + Intronic
1154967847 18:21377578-21377600 AGCCTCCCAAGTGGCCAGGCTGG - Intronic
1155956757 18:31961036-31961058 CACCTCCCGGGTGGGGCGGCTGG - Intergenic
1156326184 18:36077453-36077475 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1158505545 18:58044041-58044063 GGCCTCCAGCGCGGCGCGGCGGG - Intergenic
1159192267 18:65061733-65061755 AGCCTCCCGAGTGGAGTAGCTGG + Intergenic
1159340404 18:67126781-67126803 CACCTCCCGGGCGGGGCGGCTGG + Intergenic
1161069633 19:2253644-2253666 CGCCTCGCTGGTGGCGCTGCTGG - Exonic
1162279049 19:9680324-9680346 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1162322785 19:9979664-9979686 AGCCTCCCGAGTGGCACTACAGG - Intronic
1162435414 19:10654913-10654935 CGGGTCCCGAGTTCCGCGGCGGG + Intronic
1163542440 19:17918890-17918912 CACCTCCCGAACGGGGCGGCTGG - Intergenic
1163663990 19:18594611-18594633 CACCTCCCCAGGGGCGCAGCCGG - Intronic
1163909370 19:20175926-20175948 CACCTCCCGGATGGGGCGGCTGG + Intronic
1164043143 19:21511175-21511197 CACCTCCCGGATGGGGCGGCTGG + Intronic
1164192581 19:22927255-22927277 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1164298367 19:23937052-23937074 CACCTCCCGAACGGGGCGGCTGG + Intronic
1164693855 19:30228914-30228936 CGCCTCCCGAGTCTCGCCACAGG - Intronic
1165295343 19:34922026-34922048 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1165540912 19:36491414-36491436 CGCCTCCCGGACGGGGCGGCTGG - Intergenic
1165696950 19:37907602-37907624 CGGCTCCCGAGTGGCACAGCCGG - Intronic
1166079347 19:40434041-40434063 CGCCTCCCGGGTACCCCGGCCGG + Intergenic
1166162470 19:40965107-40965129 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1166417913 19:42610261-42610283 CACCTCCCGGATGGGGCGGCTGG + Intronic
1167897435 19:52593374-52593396 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1167970513 19:53186543-53186565 CACCTCCCGGATGGGGCGGCTGG + Intronic
1167970843 19:53187293-53187315 CACCTCCCGGATGGGGCGGCTGG + Intronic
1168114603 19:54214873-54214895 CACCTCCCGGATGGGGCGGCTGG + Intronic
1202658276 1_KI270708v1_random:44438-44460 AGCCTCCCGAGTAGCTGGGCTGG - Intergenic
925403590 2:3591349-3591371 CACCTCCCGGATGGGGCGGCTGG + Intergenic
926639480 2:15219919-15219941 CACCTCCCGGATGGGGCGGCTGG + Intronic
927747293 2:25634132-25634154 CACCTCCCGGATGGGGCGGCTGG - Intronic
927809485 2:26173467-26173489 CGTCTCCCGGGAGGCGCGCCAGG - Intronic
928002852 2:27539711-27539733 CACCTCCCGGATGGGGCGGCTGG + Intronic
928005097 2:27557307-27557329 CACCTCCCGGATGGGGCGGCTGG + Intronic
928557886 2:32447347-32447369 CACCTCCCGGATGGGGCGGCTGG + Intronic
929416531 2:41748096-41748118 CACCTCCCGGATGGGGCGGCTGG - Intergenic
929447668 2:42014325-42014347 CACCTCCCGGATGGGGCGGCTGG + Intergenic
929739867 2:44589030-44589052 CACCTCCCGGATGGGGCGGCCGG - Intronic
929739967 2:44589284-44589306 CACCTCCCGGATGGGGCGGCTGG - Intronic
930079181 2:47433240-47433262 CACCTCCCGGATGGGGCGGCTGG + Intronic
930079259 2:47433445-47433467 CACCTCCCGGATGGGGCGGCTGG + Intronic
930665510 2:54095925-54095947 CTCCTCCCGGATGGGGCGGCTGG + Intronic
933735077 2:85488100-85488122 CACCTCCCGGATGGGGCGGCTGG - Intergenic
935630449 2:105210259-105210281 CACCTCCCGGATGGGGCGGCTGG + Intergenic
935630629 2:105210688-105210710 CACCTCCCGGATGGGGCGGCTGG + Intergenic
938534268 2:132222235-132222257 CACCTCCCGGATGGGGCGGCTGG - Intronic
939578380 2:143921903-143921925 CACCTCCCGGGTGGGGCGGCTGG + Intergenic
940299317 2:152160897-152160919 CACCTCCCGGATGGGGCGGCTGG - Intronic
940643774 2:156369526-156369548 CACCTCCCGGATGGGGCGGCTGG - Intergenic
941768881 2:169327333-169327355 CACCTCCCGGATGGGGCGGCTGG - Intronic
941768977 2:169327555-169327577 CACCTCCCGGATGGGGCGGCTGG - Intronic
942020967 2:171866729-171866751 CACCTCCCGGATGGGGCGGCTGG + Intronic
944532743 2:200683221-200683243 CACCTCCCGGATGGGGCGGCTGG + Intergenic
944625217 2:201563110-201563132 CACCTCCCGGATGGGGCGGCTGG + Intronic
945090327 2:206171705-206171727 CACCTCCCGGATGGGGCGGCTGG + Intergenic
945233041 2:207610815-207610837 CACCTCCCGGATGGGGCGGCTGG - Exonic
945233299 2:207611419-207611441 CACCTCCCGGATGGGGCGGCTGG - Exonic
946318209 2:218931746-218931768 CACCTCCCGGATGGGGCGGCTGG - Intergenic
946750987 2:222896074-222896096 CACCTCCCGGATGGGGCGGCTGG + Intronic
946929166 2:224655525-224655547 CGCCTCCGGAGGGGCAGGGCTGG + Intergenic
947797977 2:232906242-232906264 CACCTCCCGGATGGGGCGGCTGG - Intronic
948247754 2:236500820-236500842 AGCCTCCCGAGTAGCTGGGCAGG + Intronic
1169247243 20:4033474-4033496 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1169264622 20:4160375-4160397 AGCCTCCCCAGGGGTGCGGCAGG - Intronic
1169718335 20:8644727-8644749 CACCTCCCGGGCGGGGCGGCTGG - Intronic
1170424933 20:16227664-16227686 CACCTCCCGAACGGGGCGGCTGG + Intergenic
1171366001 20:24625958-24625980 CACCTCCCGGATGGGGCGGCTGG + Intronic
1172721242 20:37000920-37000942 CACCTCCCGGATGGGGCGGCTGG - Intronic
1173273051 20:41555200-41555222 CACCTCCCGGATGGGGCGGCTGG + Intronic
1173769587 20:45645967-45645989 TCCCTCCCGGGTGGGGCGGCTGG + Intergenic
1174878244 20:54250352-54250374 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1175361147 20:58413740-58413762 CACCTCCCGGGTGGGGCCGCTGG + Intronic
1175361219 20:58413916-58413938 CACCTCCCGGATGGGGCGGCTGG + Intronic
1176852866 21:13935739-13935761 CACCTCCCAGATGGCGCGGCTGG + Intergenic
1177178460 21:17720504-17720526 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1179803381 21:43822431-43822453 CACCTCCCGTATGGGGCGGCTGG - Intergenic
1180125146 21:45785362-45785384 CACCTCCCGGATGGGGCGGCTGG - Intronic
1180125221 21:45785533-45785555 CACCTCCCGGATGGGGCGGCTGG - Intronic
1181301496 22:21883884-21883906 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1181586248 22:23854930-23854952 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1181586583 22:23855683-23855705 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1181657807 22:24317227-24317249 CACCTCCCGGATGGGGCGGCTGG + Intronic
1181657958 22:24317576-24317598 CGCCTCCCGGACGGGGCGGCTGG + Intronic
1182343525 22:29643885-29643907 CACCTCCCGGATGGGGCGGCTGG + Intronic
1182539187 22:31027749-31027771 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1183586383 22:38755550-38755572 CGGCTGACCAGTGGCGCGGCAGG + Intronic
1183995692 22:41631233-41631255 CACCTCCCGGATGGGGCGGCTGG + Intronic
1184203039 22:42982274-42982296 CACCTCCCGGATGGGGCGGCTGG - Intronic
1184742846 22:46439154-46439176 AGACCCCCGTGTGGCGCGGCGGG + Intronic
950412670 3:12849622-12849644 CACCTCCCGGGCGGGGCGGCTGG + Intronic
950463273 3:13138357-13138379 TGCCTCCCGAGAGGAGCGGCTGG + Intergenic
952364728 3:32664284-32664306 CACCTCCCGGATGGGGCGGCTGG - Intergenic
952442258 3:33342840-33342862 AGCCTCCCGAGTAGCGTAGCTGG + Intronic
952892655 3:38053595-38053617 CACCTCCCGGATGGGGCGGCTGG - Intronic
952896371 3:38081537-38081559 CACCTCCCGGATGGGGCGGCTGG + Intronic
953426412 3:42798687-42798709 CACCTCCCGGGCGGGGCGGCTGG - Intronic
954162837 3:48734534-48734556 CACCTCCCGGATGGGGCGGCTGG - Intronic
954399273 3:50311408-50311430 CACCTCCCGGATGGGGCGGCTGG + Intronic
954399448 3:50311811-50311833 CACCTCCCGGATGGGGCGGCTGG + Intronic
955674324 3:61434388-61434410 CACCTCCCGGGCGGGGCGGCTGG + Intergenic
959201634 3:103254919-103254941 CACCTCCCGGGTGGGGCGGCTGG + Intergenic
959415068 3:106073413-106073435 CACCTCCCGGATGGGGCGGCTGG + Intergenic
959419384 3:106111944-106111966 CTCCTCCCGGATGGCACGGCTGG + Intergenic
959419404 3:106111991-106112013 CTCCTCCCGGATGGCACGGCTGG + Intergenic
960029892 3:113046237-113046259 CACCTCCCGGATGGGGCGGCTGG + Intergenic
960029962 3:113046412-113046434 CACCTCCCGGATGGGGCGGCTGG + Intergenic
960577520 3:119242766-119242788 CACCTCCCGGGCGGGGCGGCTGG - Intergenic
960780317 3:121313055-121313077 CACCTCCCGGATGGGGCGGCTGG + Intronic
960955100 3:123026391-123026413 CCACTCCCGCCTGGCGCGGCGGG + Intronic
961163720 3:124750176-124750198 CACCTCCCGGATGGGGCGGCTGG + Intergenic
961163796 3:124750353-124750375 CACCTCCCGGATGGGGCGGCTGG + Intergenic
961163874 3:124750530-124750552 CACCTCCCGGATGGGGCGGCTGG + Intergenic
961554508 3:127688817-127688839 GTCCTCCCCAGTGGCGGGGCAGG + Intergenic
961784094 3:129339054-129339076 CACCTCCCGGGCGGGGCGGCTGG + Intergenic
961962722 3:130868825-130868847 CACCTCCCGGATGGGGCGGCTGG - Intronic
962323075 3:134407169-134407191 CTCCTGCCGAGTGGCAGGGCAGG - Intergenic
963244701 3:143047639-143047661 CGCCTCCCGGACGGGGCGGCTGG + Intronic
963498595 3:146097198-146097220 CACCTCCCGGATGGGGCGGCTGG - Intronic
963911148 3:150819997-150820019 CACCTCCCGGATGGGGCGGCTGG + Intergenic
966617188 3:181925899-181925921 CACCTCCCGAATGGGGCGGCTGG + Intergenic
966784316 3:183609171-183609193 CACCTCCCGGATGGGGCGGCTGG - Intergenic
967176362 3:186864979-186865001 CACCTCCCGGATGGGGCGGCTGG - Intergenic
967177533 3:186874081-186874103 CACCTCCCGGATGGGGCGGCTGG - Intergenic
967711322 3:192711307-192711329 CACCTCCCGGATGGGGCGGCTGG - Intronic
967896551 3:194400496-194400518 CACCTCCCGGATGGGGCGGCCGG - Intergenic
967896580 3:194400573-194400595 CACCTCCCGGATGGGGCGGCTGG - Intergenic
967924127 3:194633204-194633226 CGCCTCCCCCATGGCGCGGCTGG + Exonic
968316695 3:197731589-197731611 CACCTCCCGGATGGGGCGGCTGG + Intronic
968411687 4:395847-395869 CACCTCCCGGATGGGGCGGCTGG - Intergenic
968411829 4:396170-396192 CACCTCCCGGATGGGGCGGCTGG - Intergenic
968507202 4:976264-976286 CACCTCCCGGATGGGGCGGCTGG - Intronic
969344696 4:6563515-6563537 CGGCTCCGGAGCGGCGGGGCCGG + Intronic
969920240 4:10531554-10531576 AGCCTCCCGAGTAGCGTGGCTGG + Intronic
971282032 4:25249448-25249470 CGCCTCCCGGATGGGGCGGCTGG + Intronic
972288402 4:37669256-37669278 CACCTCCCGGATGGGGCGGCTGG - Intronic
973593731 4:52465629-52465651 CACCTCCCGGATGGGGCGGCTGG - Intergenic
973593886 4:52465986-52466008 CACCTCCCGGATGGGGCGGCTGG - Intergenic
973784916 4:54325389-54325411 CACCTCCCGGATGGGGCGGCTGG + Intergenic
973958688 4:56088453-56088475 AGCCTCCCAAGTGGGGAGGCTGG + Intergenic
974021160 4:56693452-56693474 CACCTCCCGGATGGGGCGGCTGG + Intergenic
974076673 4:57173487-57173509 CACCTCCCGGATGGGGCGGCTGG - Intergenic
975685877 4:76917547-76917569 CTCCTCCCGGATGGGGCGGCTGG - Intergenic
975686200 4:76918263-76918285 CACCTCCCGGATGGGGCGGCTGG - Intergenic
976184443 4:82430345-82430367 AGCCCCGCGAGTGGCGCGCCGGG - Intergenic
976246495 4:83010852-83010874 CGCCTCCCGGGTGGGGCGGGCGG - Intronic
976265559 4:83185200-83185222 CACCTCCCGGATGGGGCGGCTGG + Intergenic
977205180 4:94158246-94158268 CACCTCCCGGGCGGGGCGGCTGG - Intergenic
978123713 4:105110640-105110662 CACCTCCCGGATGGGGCGGCTGG - Intergenic
978527091 4:109678349-109678371 CACCTCCCAGGTGGGGCGGCCGG + Intronic
980895329 4:138854665-138854687 CACCTCCCGGATGGGGCGGCTGG - Intergenic
982026036 4:151254915-151254937 CACCTCCCGGGAGGGGCGGCTGG + Intronic
983218004 4:165019804-165019826 CACCTCCCGGGCGGGGCGGCTGG + Intergenic
984803528 4:183735335-183735357 CACCTCCCGGATGGGGCGGCTGG + Intergenic
984804022 4:183736473-183736495 CCCCTCCCGGATGGGGCGGCTGG + Intergenic
984977112 4:185240488-185240510 CACCTCCCGGATGGGGCGGCTGG + Intronic
985359853 4:189162198-189162220 CATCTCCCAAGTGGCGGGGCCGG - Intergenic
985736572 5:1586527-1586549 CACCTCCCGGATGGGGCGGCTGG - Intergenic
988925746 5:35989970-35989992 AGCCTCCCGAGTAGCTGGGCTGG - Intronic
989061501 5:37415529-37415551 TCCCTCCCGGGTGGGGCGGCTGG + Intronic
989075905 5:37563521-37563543 CACCTCCCGGATGGGGCGGCTGG + Intronic
989211544 5:38862385-38862407 CACCTCCCGGATGGGGCGGCTGG + Intronic
989379965 5:40801175-40801197 CACCTCCCGGATGGGGCGGCTGG - Intergenic
989587477 5:43087121-43087143 CACCTCCCGGATGGGGCGGCTGG + Intronic
989633997 5:43515197-43515219 AGCCTCCGGAGTGGAGGGGCGGG - Intergenic
989634892 5:43522351-43522373 CACCTCCCGGGCGGGGCGGCTGG - Intergenic
990164996 5:52985029-52985051 AGCCTCCCGAGTAGCTGGGCAGG - Intergenic
990382917 5:55233466-55233488 CGCCGCCCGAGCGGGGAGGCGGG - Exonic
990426621 5:55695862-55695884 CACCTCCCGGATGGGGCGGCTGG + Intronic
990456609 5:55994982-55995004 CGCCACCCCAGTCCCGCGGCGGG + Exonic
990458946 5:56014819-56014841 CACCTCCCGGATGGGGCGGCTGG + Intergenic
991907149 5:71525357-71525379 CACCTCCCGGATGGGGCGGCTGG + Intronic
992289758 5:75270663-75270685 CACCTCCCGGATGGGGCGGCTGG - Intergenic
992463681 5:76984860-76984882 CCCCTCCCGGATGGGGCGGCTGG + Intergenic
992978053 5:82139736-82139758 CGCCTCCCGGACGGGGCGGCTGG - Intronic
994067733 5:95562089-95562111 AGCCTCCCGAGTAGCTGGGCAGG - Intronic
995735546 5:115296549-115296571 CGCGGCCCGAGTAGCTCGGCGGG - Exonic
996862647 5:128083683-128083705 CGCCTCCCGCGTGCTGCTGCCGG + Intergenic
997892474 5:137687565-137687587 CACCTCCCGGATGGGGCGGCTGG - Intronic
998053761 5:139056717-139056739 CACCTCCCGGGCGGGGCGGCTGG - Intronic
999180984 5:149670278-149670300 CACCTCCCGGATGGGGCGGCTGG + Intergenic
999181059 5:149670452-149670474 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1001646160 5:173283868-173283890 CGCCACCCCAGCGGCGCTGCAGG + Intergenic
1002014204 5:176306312-176306334 CACCTCCCGGATGGGGCGGCTGG - Intronic
1002205461 5:177560061-177560083 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1005158813 6:22836675-22836697 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1005158865 6:22836803-22836825 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1005886621 6:30102215-30102237 CGCCTCCCAGGCGCCGCGGCCGG + Intergenic
1005933156 6:30498749-30498771 CACCTCCCGAACGGGGCGGCTGG + Intergenic
1006209673 6:32384780-32384802 CACCTCCCGGATGGCGCGGCTGG + Intergenic
1006472528 6:34236814-34236836 CGCCCCCTGAGTGACACGGCTGG + Intergenic
1008480735 6:51982209-51982231 CACCTCCCGGATGGGGCGGCTGG - Intronic
1010264352 6:73851023-73851045 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1010513336 6:76744897-76744919 CACCTCCCGGGTGGGGCGGCTGG - Intergenic
1011474151 6:87735933-87735955 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1012983574 6:105853829-105853851 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1013244053 6:108270334-108270356 CACCTCCCGGATGGTGCGGCTGG - Intergenic
1013472313 6:110476484-110476506 CGCCTCCCGCGTGGCGCCGCGGG + Intronic
1016123594 6:140373815-140373837 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1017465197 6:154687487-154687509 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1017857981 6:158367972-158367994 CGCCTCCCGAGTAGCTGGGAGGG - Intronic
1019156698 6:170044038-170044060 CGCCTCCTGTGTGGCGTTGCAGG - Intergenic
1019458669 7:1146075-1146097 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1019458924 7:1146675-1146697 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1019714869 7:2534165-2534187 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1019909941 7:4094174-4094196 AGCCTCCCGAGTAGAGTGGCTGG + Intronic
1019953245 7:4390370-4390392 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1021120154 7:16789647-16789669 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1021120271 7:16789920-16789942 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1021450332 7:20778262-20778284 CGCAGCCCGAGGGGAGCGGCGGG + Intergenic
1021735939 7:23638115-23638137 CTCCTCCCGGATGGGGCGGCTGG - Intronic
1022083347 7:27045018-27045040 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1022083568 7:27045547-27045569 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1022393260 7:29961742-29961764 CACCTCCCGGATGGGGCGGCTGG + Intronic
1022663473 7:32387595-32387617 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1022700403 7:32754140-32754162 CACCTCCCGAATGGGGCGGCTGG - Intergenic
1024538847 7:50460081-50460103 CACCTCCCGGATGGGGCGGCTGG - Intronic
1024984344 7:55182422-55182444 CGCCTCACGAATGACTCGGCAGG - Intronic
1025103461 7:56151929-56151951 CACCTCCCAGGTGGGGCGGCTGG - Intergenic
1025803451 7:64809179-64809201 CACCTCCCGGGTGGGGCAGCTGG + Intronic
1025803476 7:64809228-64809250 TCCCTCCCGGGTGGGGCGGCTGG + Intronic
1025853476 7:65259639-65259661 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1025979115 7:66393327-66393349 CACCTCCCGGATGGGGCGGCTGG + Intronic
1026825507 7:73578859-73578881 CGCGTCTCGAGGGGCGGGGCTGG + Intergenic
1027371403 7:77509978-77510000 CGCCTCCCGGACGGGGCGGCCGG - Intergenic
1027774018 7:82443317-82443339 CGCCGGCCGAGGGGCGCCGCGGG - Intronic
1028227362 7:88266397-88266419 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1028430729 7:90744605-90744627 CACCTCCCGGATGGGGCGGCTGG + Intronic
1028685470 7:93585927-93585949 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1028685521 7:93586054-93586076 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1029468714 7:100741477-100741499 CACCTCCCGGATGGGGCGGCTGG + Intronic
1030036167 7:105410600-105410622 CACCTCCCGGGCGGGGCGGCTGG + Intergenic
1030368426 7:108671789-108671811 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1031134747 7:117873094-117873116 CGCTTCCCGTGGGGCGCGGAAGG + Intronic
1032291291 7:130591497-130591519 CACCTCCCGGATGGGGCGGCTGG - Intronic
1032291414 7:130591800-130591822 CACCTCCCGGATGGGGCGGCTGG - Intronic
1032569660 7:132985096-132985118 CACCTCCCGGATGGGGCGGCTGG - Intronic
1032569865 7:132985575-132985597 CACCTCCCGGATGGGGCGGCTGG - Intronic
1032589410 7:133177752-133177774 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1033099767 7:138460350-138460372 CGCCTCCCGAGTGGCGCGGCCGG - Exonic
1033099951 7:138461003-138461025 CGCCGCCCGGGGTGCGCGGCGGG + Intronic
1033324091 7:140363093-140363115 CACCTCCCGGATGGGGCGGCTGG - Intronic
1034638334 7:152585246-152585268 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1034638641 7:152585947-152585969 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1034723367 7:153314947-153314969 CGCCTCCCGGACGGGGCGGCTGG + Intergenic
1035486563 7:159231013-159231035 GGCCACCCGAGTGGAGCGGCCGG + Intergenic
1036096044 8:5725615-5725637 CACCTCCCGAGTGGCTGGCCGGG - Intergenic
1036506962 8:9365095-9365117 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1038595463 8:28881854-28881876 CACCTCCCGGATGGGGCGGCTGG - Intronic
1038808069 8:30812659-30812681 CGACTCCCGCGGCGCGCGGCCGG - Exonic
1040069547 8:43179206-43179228 CACCTCCCGGATGGGGCGGCTGG + Intronic
1040069799 8:43179803-43179825 CACCTCCCGGATGGGGCGGCTGG + Intronic
1040093231 8:43419393-43419415 CGCCTCCCGGATGGGGCAGCTGG + Intergenic
1040785552 8:51159359-51159381 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1040819010 8:51535117-51535139 CACCTCCCGGATGGGGCGGCTGG - Intronic
1042196238 8:66232837-66232859 CACCTCCAGGGTGGGGCGGCTGG - Intergenic
1042475872 8:69246260-69246282 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1043985947 8:86694317-86694339 CACCTCCCGGATGGGGCGGCTGG + Intronic
1045128273 8:99119358-99119380 AGCCTCCCGAGTGGCTGGGTGGG + Intronic
1045195686 8:99927428-99927450 CACCTCCCGGGCGGGGCGGCTGG - Intergenic
1045235831 8:100351568-100351590 CACCTCCCGAACGGGGCGGCTGG - Intronic
1045298602 8:100892496-100892518 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1045510070 8:102806893-102806915 CGCCCCCCGGGCCGCGCGGCAGG - Intergenic
1045524265 8:102928732-102928754 CACCTCCCGGGCGGGGCGGCTGG - Intronic
1046636903 8:116680226-116680248 CACCTCCCGGATGGGGCGGCTGG - Intronic
1046871283 8:119208348-119208370 CTCCTCCCGCGCGGCGCGCCCGG + Intronic
1047719955 8:127630236-127630258 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1049219435 8:141422216-141422238 CGCCTCCCGACGGGCCCGGCAGG - Exonic
1049704935 8:144037217-144037239 CACCTCCCGGGCGGGGCGGCCGG - Intronic
1049844176 8:144792148-144792170 CGACTCACGATTAGCGCGGCCGG + Intronic
1050417904 9:5434363-5434385 CACCTCCCAAATGGGGCGGCCGG - Intronic
1050512948 9:6413654-6413676 AGCCTCGCTAGGGGCGCGGCGGG - Intronic
1051661787 9:19433749-19433771 CACCTCCCGGATGGGGCGGCTGG + Intronic
1052492589 9:29188668-29188690 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1052858800 9:33423811-33423833 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1055133799 9:72806139-72806161 CACCTCCCGGGCGGGGCGGCTGG + Intronic
1055137050 9:72840443-72840465 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1055586613 9:77762321-77762343 CACCTCCCAGGTGGGGCGGCTGG - Intronic
1055586689 9:77762497-77762519 CACCTCCCAGGTGGGGCGGCTGG - Intronic
1056624745 9:88244863-88244885 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1056706850 9:88959296-88959318 CACCTCCCGGGTGGGGCGGCTGG + Intergenic
1057629391 9:96707561-96707583 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1057751682 9:97797043-97797065 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1057772995 9:97983957-97983979 AGCCTCCCGGGATGCGCGGCCGG + Intronic
1058661674 9:107272488-107272510 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1060350292 9:122852781-122852803 CACCTCCCGGATGGGGCGGCTGG - Intronic
1060682512 9:125577704-125577726 CACCTCCCGGATGGGGCGGCCGG - Intronic
1060967516 9:127720218-127720240 CGTTTCCCGGGTGGGGCGGCAGG - Intronic
1061427092 9:130506487-130506509 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1061559546 9:131393955-131393977 CCGCTCCCGGGAGGCGCGGCAGG + Intergenic
1062392942 9:136341185-136341207 CGCATCCTGAGTGGCGCTGCAGG + Intronic
1062504646 9:136866623-136866645 CTCCGCCCGCGTGGCCCGGCCGG - Intronic
1203405807 Un_KI270539v1:876-898 CACCTCCCGCATGGGGCGGCTGG - Intergenic
1187281412 X:17860868-17860890 CGCCGCCCGTGTGGCGCGCCGGG - Intronic
1189210466 X:39278283-39278305 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1189458073 X:41211861-41211883 CACCTCCCGGATGGGGCGGCTGG - Intronic
1189506052 X:41612904-41612926 CACCTCCCGGATGGGGCGGCTGG - Intronic
1189837475 X:45040105-45040127 CACCTCCCGGATGGGGCGGCTGG + Intronic
1189955978 X:46275915-46275937 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1189968194 X:46395252-46395274 CCCCTCCCGGATGGGGCGGCTGG + Intergenic
1190505084 X:51119257-51119279 CACCTCCCGAATGGGGCGGCTGG + Intergenic
1190779427 X:53579347-53579369 CACCTCCCGGATGGGGCGGCTGG - Intronic
1190891451 X:54572600-54572622 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1191794102 X:65002419-65002441 CACCTCCCGGATGGGGCGGCTGG - Intronic
1191835454 X:65457465-65457487 CACCTCCCGGATGGGGCGGCTGG - Intronic
1192500081 X:71645007-71645029 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1192500102 X:71645049-71645071 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1192567983 X:72179375-72179397 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1192664054 X:73069473-73069495 CACCTCCCAAATGGGGCGGCTGG - Intergenic
1192768666 X:74166852-74166874 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1194991867 X:100555501-100555523 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1194992050 X:100555933-100555955 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1195009990 X:100724270-100724292 CACCTCCCGGATGGGGCGGCTGG - Intronic
1195257489 X:103104444-103104466 CACCTCCCGGATGGGGCGGCTGG + Intergenic
1197241691 X:124128540-124128562 CACCTCCCGTGCGGGGCGGCTGG + Intronic
1197453031 X:126641734-126641756 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1197735984 X:129850721-129850743 CACCTCCCGGATGGGGCGGCTGG - Intergenic
1198246901 X:134839584-134839606 CACCTCCCGGATGGGGCGGCTGG - Intronic