ID: 1033101489

View in Genome Browser
Species Human (GRCh38)
Location 7:138476616-138476638
Sequence TAATGCTGTACCTATTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 1, 2: 0, 3: 24, 4: 159}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033101489_1033101493 0 Left 1033101489 7:138476616-138476638 CCCCCAAAATAGGTACAGCATTA 0: 1
1: 1
2: 0
3: 24
4: 159
Right 1033101493 7:138476639-138476661 TACTTTGACATTATACTTTTTGG No data
1033101489_1033101494 1 Left 1033101489 7:138476616-138476638 CCCCCAAAATAGGTACAGCATTA 0: 1
1: 1
2: 0
3: 24
4: 159
Right 1033101494 7:138476640-138476662 ACTTTGACATTATACTTTTTGGG 0: 1
1: 0
2: 3
3: 35
4: 413
1033101489_1033101496 17 Left 1033101489 7:138476616-138476638 CCCCCAAAATAGGTACAGCATTA 0: 1
1: 1
2: 0
3: 24
4: 159
Right 1033101496 7:138476656-138476678 TTTTGGGTGAAACTGAGGAAAGG 0: 1
1: 0
2: 1
3: 50
4: 370
1033101489_1033101495 12 Left 1033101489 7:138476616-138476638 CCCCCAAAATAGGTACAGCATTA 0: 1
1: 1
2: 0
3: 24
4: 159
Right 1033101495 7:138476651-138476673 ATACTTTTTGGGTGAAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033101489 Original CRISPR TAATGCTGTACCTATTTTGG GGG (reversed) Intronic
908581110 1:65518336-65518358 TAATCTTGTCTCTATTTTGGGGG + Intronic
910413796 1:86975291-86975313 TTAAGCTTTTCCTATTTTGGTGG + Intronic
911075710 1:93872418-93872440 TAATCCTGTCCCTAATTTAGCGG - Intronic
911897043 1:103449290-103449312 TACTACTGTAACTGTTTTGGGGG - Intergenic
920935971 1:210434879-210434901 ATATGATGTACATATTTTGGGGG + Intronic
922039836 1:221886187-221886209 TAATGCTCTCCCAATCTTGGGGG - Intergenic
922365337 1:224858042-224858064 CCATTCTGTACATATTTTGGGGG + Intergenic
1068090591 10:52428411-52428433 AAAAGTTGTACATATTTTGGGGG + Intergenic
1070538432 10:77397373-77397395 TAATAGTGTACATATTTTGGGGG + Intronic
1071130875 10:82392023-82392045 TAATGCTTTTCCTAGTTTCGTGG - Intronic
1073635594 10:105195203-105195225 GTGTGCTGTACCTATTTTGCTGG + Intronic
1080168141 11:29265279-29265301 TAATACTGTACTTATTTTAATGG - Intergenic
1085221386 11:74876508-74876530 TAATGATGGTCCTATTTTGGGGG - Intronic
1085838091 11:79977892-79977914 TTATGTTGTAGCTATATTGGGGG + Intergenic
1086530006 11:87773850-87773872 TAATTATTTACCTATTTTTGGGG + Intergenic
1088433771 11:109787885-109787907 GAATCCTGTAGCTATTTTTGCGG + Intergenic
1088715921 11:112549642-112549664 GAATGCAGAATCTATTTTGGAGG - Intergenic
1093433994 12:19114755-19114777 TAACACGATACCTATTTTGGGGG - Intergenic
1095524092 12:43104557-43104579 AAATGCTGTGACTACTTTGGAGG + Intergenic
1095681595 12:44982939-44982961 TTATACAGTATCTATTTTGGAGG + Intergenic
1097350395 12:58542702-58542724 TAATCTTGTACCTGGTTTGGGGG - Intergenic
1100852728 12:98730069-98730091 TTAAGTTGTACATATTTTGGGGG - Intronic
1102405959 12:112674487-112674509 TAATGCTGGACCTCTTTTGTTGG + Intronic
1105277031 13:18940295-18940317 TAATGCTGTCCTTATTTGTGAGG + Intergenic
1105571813 13:21610576-21610598 CAGAGCTGTACCTAGTTTGGGGG + Intergenic
1105988671 13:25595554-25595576 TAAGGCTGGAGCTACTTTGGGGG + Intronic
1106867053 13:33976671-33976693 AATTGTTGTACATATTTTGGGGG - Intergenic
1106925752 13:34611241-34611263 TAATTGTGTGGCTATTTTGGGGG - Intergenic
1111850977 13:93574433-93574455 TTATTCTTTACATATTTTGGAGG + Intronic
1114743866 14:25125532-25125554 TAATGCAGTGCCTGTTTTGTGGG + Intergenic
1115002394 14:28438951-28438973 TAATGCTTGACCTGTGTTGGTGG + Intergenic
1116427698 14:44810382-44810404 TAATGATGAAGTTATTTTGGAGG + Intergenic
1116958496 14:50946676-50946698 TAATGCTGTGACCATCTTGGGGG - Intergenic
1119062048 14:71485052-71485074 TGATCCTTTAGCTATTTTGGAGG + Intronic
1120589650 14:86360637-86360659 TAATGTTGTTCCTATTTTGCAGG - Intergenic
1122730946 14:103797611-103797633 TAATTCTGTAGGCATTTTGGGGG - Intronic
1124329991 15:28803118-28803140 GAGTTCTTTACCTATTTTGGAGG + Intergenic
1124715162 15:32052984-32053006 AATAGCTGTACATATTTTGGAGG - Intronic
1125395047 15:39237824-39237846 TAATACTATAACTATTTTGAAGG - Intergenic
1125817456 15:42598600-42598622 TATTGATATACATATTTTGGGGG + Intronic
1126269611 15:46799230-46799252 AATTGCTGTACATATTTTGGGGG - Intergenic
1128579200 15:68797083-68797105 TATAGTTGTACTTATTTTGGGGG - Intronic
1133911911 16:10073529-10073551 TAATGCTGTACTGGTTTTGGAGG - Intronic
1134406193 16:13960795-13960817 GGATTCTGTACCTATTTTGAAGG + Intergenic
1134434228 16:14240680-14240702 AAATTCAGAACCTATTTTGGAGG - Intronic
1135552188 16:23406978-23407000 TAATTCTGTACATATTTAGATGG - Intronic
1137933705 16:52612901-52612923 AATAGCTGTACATATTTTGGGGG + Intergenic
1143340101 17:6204154-6204176 AATTGTTGTACTTATTTTGGGGG + Intergenic
1146283824 17:31561095-31561117 TACTGTTGTCCCTGTTTTGGGGG + Intergenic
1147839524 17:43361497-43361519 TAATATTGTTACTATTTTGGAGG + Intergenic
1149236568 17:54597589-54597611 CAAGGCTGTACATATTTTGTTGG - Intergenic
1149330129 17:55572316-55572338 TAATACTGGACCCATTTTGTTGG + Intergenic
1149737750 17:59012268-59012290 GAATTCTGTCCCTTTTTTGGTGG - Intronic
1149832109 17:59881533-59881555 CATAGCTGTACTTATTTTGGGGG + Intronic
1153427052 18:4976356-4976378 TATAGTTGTACATATTTTGGGGG - Intergenic
1155405240 18:25480713-25480735 TAATGAAGTACCTATTTTGTAGG - Intergenic
1155516972 18:26633536-26633558 TAATACTGTACACATTTGGGGGG - Intronic
1156766155 18:40658125-40658147 TATTTCTGTACCTTTTTTGGGGG - Intergenic
1161162150 19:2767529-2767551 TGTTGCTGTTCTTATTTTGGGGG + Intronic
1162304985 19:9866961-9866983 TAATCCTGGACCTGTTTTAGAGG - Intronic
1162652459 19:12100560-12100582 TAATGCTGTATCTGTGTTTGAGG + Intronic
1162677654 19:12312298-12312320 TAATTCTGTACCTGTGTTAGAGG - Intergenic
927024816 2:19055883-19055905 TAATGCTGAACTTTTTTTGTTGG + Intergenic
928049937 2:27981005-27981027 TAATGCTGTACTTATTTATGGGG - Intronic
928236930 2:29551085-29551107 TTAAACTGTACATATTTTGGTGG - Intronic
929191967 2:39148417-39148439 TAATGCTGTATCTATTTGGAAGG + Intergenic
931781987 2:65586838-65586860 CAATGCAGTAACTAATTTGGAGG - Intergenic
932102435 2:68913120-68913142 TAATCCTGTATATATTTTGAAGG + Intergenic
932541119 2:72653683-72653705 TAATATTGTACCTCTTTTAGAGG - Intronic
932634024 2:73372226-73372248 TAATGCTTTACCAATTTTCTAGG - Intergenic
932635474 2:73384662-73384684 TGATGCTGAACCAATGTTGGTGG - Intergenic
936735305 2:115434562-115434584 TAATGTGGTACATATTTTGGAGG + Intronic
938509246 2:131923135-131923157 TGAAGCTGTAGCTGTTTTGGGGG + Intergenic
939263713 2:139843970-139843992 ATATTCTGTACATATTTTGGGGG + Intergenic
940088560 2:149890237-149890259 TAATTCTGGACCTATTTTCAAGG + Intergenic
942945627 2:181669060-181669082 TAATTCTGTACCTATGTTACAGG + Intronic
947387238 2:229603719-229603741 TTGAGCTGTACATATTTTGGGGG + Intronic
1168899242 20:1347100-1347122 TGATCCTGTACATATTTTGTTGG + Intronic
1169240806 20:3978500-3978522 CATAGCTGTACATATTTTGGGGG - Intronic
1172295389 20:33806853-33806875 TAATACTGTTCCTATTTTATAGG - Intergenic
1174219132 20:48938456-48938478 TATAGCTGTACATATTTTTGAGG + Intronic
1176784241 21:13235405-13235427 TGAAGCTGTAGCTGTTTTGGGGG - Intergenic
1177982288 21:27929266-27929288 TGAAGCTGTAGCTGTTTTGGGGG - Intergenic
1179320670 21:40288055-40288077 TAATGCTGTTCTTAATTTAGAGG - Intronic
1182653637 22:31872431-31872453 TAATGCTGTTCCTGTCTTTGAGG - Intronic
1182755700 22:32677126-32677148 TAACGCTGTTCCTATCCTGGAGG + Intronic
951060933 3:18206484-18206506 TAATGCTGTACCTATCTTGGTGG + Intronic
951160892 3:19420091-19420113 TAATGCTGTTGCTATTTTACAGG - Intronic
953789315 3:45935145-45935167 AAATTCTGGACCTATTTTGAAGG - Intronic
957601488 3:82340587-82340609 TCATTCCGTACCTATTTTGTGGG - Intergenic
957791155 3:84942733-84942755 TAATTCTGAACCCATTTTGGGGG - Intergenic
958040976 3:88226081-88226103 TAATACTGTACATATTTATGGGG + Intergenic
958651693 3:96944507-96944529 TAATGCTGTACCTATTCAGCTGG + Intronic
959532817 3:107452938-107452960 TAATATTCTACCTATTGTGGTGG - Intergenic
960014169 3:112867668-112867690 TTCTTCTGTACCTATTTTGATGG + Intergenic
960691940 3:120355636-120355658 TAAAGATTTGCCTATTTTGGAGG - Intergenic
960795608 3:121483802-121483824 TAATGCTCTACTTAATTAGGTGG + Intronic
960852324 3:122069095-122069117 TAATGTTGAACATCTTTTGGTGG + Intronic
960930902 3:122848698-122848720 AATTGCTGTACATATTTGGGGGG + Intronic
961347027 3:126269840-126269862 TTAGGTTGTACATATTTTGGGGG - Intergenic
965106628 3:164363954-164363976 TATTATTGTACTTATTTTGGTGG - Intergenic
965934937 3:174096570-174096592 GAATGGTGTAGGTATTTTGGTGG - Intronic
966280618 3:178222297-178222319 TATTATTATACCTATTTTGGAGG - Intergenic
966606022 3:181822480-181822502 TATAGTTGTACATATTTTGGGGG + Intergenic
966675667 3:182585552-182585574 AATTGATGTACATATTTTGGGGG - Intergenic
966702057 3:182864485-182864507 TTTTTCTGTACCTATTTTGGTGG + Intronic
968880599 4:3296878-3296900 TCATGCTGTGCCTTTTTAGGAGG + Intronic
970032501 4:11692660-11692682 TAACGCTGTGCCCATTTTGGGGG + Intergenic
972976424 4:44641890-44641912 TGATGATGTGCCTATTTTGCTGG - Intronic
974771257 4:66416941-66416963 TAATGCAGTCCCTATTTTACAGG + Intergenic
977570352 4:98622459-98622481 TAATTCTTTAACTTTTTTGGGGG + Intronic
977620959 4:99136766-99136788 TAATGCTCAACATATTTTGTAGG - Intronic
978667667 4:111205153-111205175 CAAGGCAGTACCTATTTTGGGGG + Intergenic
978995868 4:115151721-115151743 TAAAGCTATAAATATTTTGGGGG + Intergenic
979744475 4:124194103-124194125 AAATGCTGTGCCTATTCTGAGGG - Intergenic
981022926 4:140047722-140047744 TTCTGCTGTGCCCATTTTGGGGG - Intronic
981773831 4:148341711-148341733 AAGAGCTGTACCTATGTTGGGGG - Intronic
984046953 4:174813343-174813365 TAAGGCTGCACTAATTTTGGTGG - Intronic
985375573 4:189333892-189333914 TATAACTGTACATATTTTGGGGG + Intergenic
986430987 5:7680960-7680982 TATTTCTGTACCTATGTTGCTGG - Intronic
988152361 5:27400861-27400883 TCATGTCATACCTATTTTGGTGG + Intergenic
992365693 5:76086874-76086896 TACTGCTGTCCCTAATTAGGAGG - Intronic
994598657 5:101872819-101872841 TATTGCTGTACCCATTTTATAGG + Intergenic
995359250 5:111275888-111275910 CAGAGTTGTACCTATTTTGGGGG - Intronic
995918972 5:117287859-117287881 TAATGCTCTCCCTTTGTTGGGGG + Intergenic
997518692 5:134508334-134508356 AATAGTTGTACCTATTTTGGGGG - Intergenic
998124384 5:139606752-139606774 TCATTCAGTAACTATTTTGGGGG + Intronic
999181424 5:149672219-149672241 TAATACTGAACCCATTTTGGTGG - Intergenic
1001677273 5:173528951-173528973 AAAAGTTGTACGTATTTTGGGGG + Intergenic
1004476185 6:15974738-15974760 TACTGCTGTAGCCATTTTGGGGG - Intergenic
1004726059 6:18312316-18312338 TAATGCTGCAGGGATTTTGGTGG + Intergenic
1005402246 6:25446985-25447007 TACTATTGTAACTATTTTGGGGG - Intronic
1005925970 6:30446045-30446067 TTGTTCAGTACCTATTTTGGGGG - Intergenic
1006930312 6:37683823-37683845 GAATGCTGTAATTATTTGGGAGG - Intronic
1008313125 6:50003015-50003037 AAATGCTGTTACTATTTTTGTGG + Intergenic
1008628510 6:53341876-53341898 TAATCCTGTGCCTACTTTGGAGG - Intronic
1012607858 6:101180910-101180932 TAATGCTATACCCCTTTTTGTGG + Intergenic
1014888021 6:126805803-126805825 TATTGCTTTACTTAATTTGGGGG + Intergenic
1015470852 6:133604479-133604501 TAATGCTGTACCAGTTTTCTAGG + Intergenic
1016687324 6:146896144-146896166 TAATGCTGTAAATATTTTAAAGG + Intergenic
1020518707 7:9158722-9158744 AAAAGTTGTACATATTTTGGAGG - Intergenic
1020849104 7:13327126-13327148 TATTTCTGTTCCTTTTTTGGGGG - Intergenic
1021086476 7:16425853-16425875 AAATGGTATACCTATTTTGGAGG - Intergenic
1021142353 7:17042992-17043014 TAAGGCTGTAGCTAATTTGAAGG - Intergenic
1021678021 7:23100436-23100458 TAAAGCTGTACCTATTCTGTGGG - Intergenic
1023121025 7:36908787-36908809 TGATACTGTACCTAATTAGGTGG - Intronic
1026515238 7:71063877-71063899 AAATCCTTTACCTATTTTGCAGG - Intergenic
1027582671 7:80018751-80018773 TAATGCTTTATCTCTTTTGTAGG - Intergenic
1028566346 7:92235848-92235870 TAATACTGTACATACTTTAGGGG + Intronic
1028754493 7:94420051-94420073 TAATGCTATATTCATTTTGGGGG - Intronic
1029506714 7:100967417-100967439 GAATGCTGTACCCGTTTTGCAGG - Exonic
1030660535 7:112213893-112213915 TAATACTGTATCTATATTGCTGG + Intronic
1031951401 7:127896179-127896201 CATAGCTGAACCTATTTTGGCGG - Intronic
1032661603 7:133990010-133990032 TATAGCTGTACGTATTTTGGGGG + Intronic
1033101489 7:138476616-138476638 TAATGCTGTACCTATTTTGGGGG - Intronic
1033159999 7:138986983-138987005 TACTGGTGTAGCCATTTTGGAGG + Intergenic
1033979025 7:147140768-147140790 TAATGCTGTACATAATTTTATGG + Intronic
1034712074 7:153202056-153202078 TTTTGCTGTAGATATTTTGGTGG + Intergenic
1038550486 8:28464156-28464178 TAATGCAGAAACTATTTGGGGGG - Intronic
1039249535 8:35646997-35647019 CAATGCTGTATCTATGTTTGAGG - Intronic
1040733889 8:50482833-50482855 TAATGATGTATTTAGTTTGGAGG + Intronic
1040985042 8:53284832-53284854 TATAGTTGTACATATTTTGGGGG - Intergenic
1041545735 8:59040430-59040452 TACTGCTGTACCTAATTTGAGGG - Intronic
1042503959 8:69539796-69539818 AAATGGTGTAACCATTTTGGTGG + Intronic
1042623790 8:70734742-70734764 TACTACTGTACCTGTTATGGAGG + Exonic
1042964850 8:74339497-74339519 TATTGCTGTTGCTATTCTGGGGG - Intronic
1043801293 8:84613730-84613752 TAATGCTTTAGCTATGTTGTTGG - Intronic
1051989492 9:23134944-23134966 CACTGTTGTACCTATTTTGGGGG + Intergenic
1052530573 9:29679084-29679106 TAATGGTGGACCTAATTTGTGGG + Intergenic
1053010517 9:34630269-34630291 AAATGCTGTTCCTTATTTGGGGG + Intergenic
1053200206 9:36147113-36147135 TAATGCTTTACCAATTCTCGAGG + Intronic
1053328534 9:37180536-37180558 GAATGCTGTATTTACTTTGGTGG + Intronic
1054938358 9:70713229-70713251 TAATGTTGTTCCTATTTTTAGGG - Intronic
1054940049 9:70731222-70731244 TAATGTTGTTCCTATTTTTAGGG - Intronic
1055759199 9:79588835-79588857 TAATTGTGTACCTTTTTTGTGGG + Intronic
1057448793 9:95138112-95138134 TAATTTTGTACCTGTTTTGTAGG - Intronic
1058641097 9:107086199-107086221 TAATTTTTTCCCTATTTTGGTGG - Intergenic
1060640475 9:125234050-125234072 TAATGCAGAAGATATTTTGGAGG - Exonic
1188842556 X:35034502-35034524 TAATGCTGTAAAGATTTTGAGGG - Intergenic
1189547044 X:42052088-42052110 AATAGCTGTATCTATTTTGGGGG + Intergenic
1191958157 X:66668877-66668899 TAATACTTTTCCTCTTTTGGGGG - Intergenic
1192549138 X:72040018-72040040 ACTTGCTGAACCTATTTTGGTGG - Intergenic
1192586297 X:72320751-72320773 AAAAGTTGTACATATTTTGGAGG - Intergenic
1195179761 X:102346346-102346368 TCATTCTGTACATATTTTTGTGG + Intergenic
1198750932 X:139935575-139935597 TACTGCTATATCTTTTTTGGGGG - Intronic