ID: 1033106294

View in Genome Browser
Species Human (GRCh38)
Location 7:138528335-138528357
Sequence TCCCCATGTTGGGGGAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 21, 3: 61, 4: 196}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033106289_1033106294 19 Left 1033106289 7:138528293-138528315 CCATAGGAGAAAGAAAAATAAAG 0: 1
1: 0
2: 11
3: 120
4: 1253
Right 1033106294 7:138528335-138528357 TCCCCATGTTGGGGGAGTGCTGG 0: 1
1: 0
2: 21
3: 61
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033106294 Original CRISPR TCCCCATGTTGGGGGAGTGC TGG Intronic
900188266 1:1342930-1342952 GCCCCATGCTGGGGGGGTGGGGG - Intronic
900188294 1:1343027-1343049 TCCCCATGCTGGGGGGGTGGGGG - Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
904012594 1:27398414-27398436 TCCCCAGGCTGGGGGAAAGCAGG + Intergenic
904696898 1:32336027-32336049 TGCCCATGATGGGGGTCTGCTGG + Exonic
909646421 1:77922024-77922046 TCCCAAAGTTGGGGGAATACAGG + Intronic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
914704101 1:150157449-150157471 TCCCCTTGTTGGGGGGCGGCGGG - Exonic
914927950 1:151905650-151905672 TCCTTTTGTTGAGGGAGTGCTGG - Intronic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
915871105 1:159560367-159560389 TCACCATCTTTGGGAAGTGCAGG + Intergenic
916125911 1:161571092-161571114 TCCTAAAGTTGGGGTAGTGCAGG - Intergenic
916135827 1:161652941-161652963 TCCTAAAGTTGGGGTAGTGCAGG - Intronic
916527883 1:165628825-165628847 TCCCTATGTGGAGGGAGTGCTGG + Intergenic
916809267 1:168291331-168291353 CCCCAAAGTTGGGGGAGTCCGGG - Exonic
918767748 1:188510824-188510846 TCATCATGTTGTGGAAGTGCAGG - Intergenic
919728593 1:200899216-200899238 GACCTATGGTGGGGGAGTGCAGG - Intronic
920043195 1:203117154-203117176 ACCCCTTGTTGGGGGACGGCTGG - Intronic
920577565 1:207072728-207072750 TCCTCATGTTGGTGAAGTGTTGG + Exonic
1063008199 10:1994863-1994885 CCGTCTTGTTGGGGGAGTGCAGG - Intergenic
1063163758 10:3441353-3441375 TCCCCATGATGGGGCTGAGCTGG - Intergenic
1068389132 10:56370462-56370484 TCCTAATGTTAAGGGAGTGCTGG - Intergenic
1069787427 10:70997824-70997846 TCTCCATGTGGTGGGAGAGCTGG + Intergenic
1070265732 10:74900811-74900833 TGCAAATGTTGGGGGAGTGGGGG + Intronic
1071400901 10:85269687-85269709 TCACCATGTTGGAGGGGTCCTGG - Intergenic
1071576052 10:86727278-86727300 TCCCCAAGTTGTGGGAATACAGG + Intronic
1072019557 10:91384401-91384423 TCTCCATGCTGTGGGAGTGTGGG + Intergenic
1073359974 10:102890319-102890341 TACCCAAGTAGGGGGATTGCTGG + Intronic
1073803894 10:107074199-107074221 GCCCGGTGTTGGGGGAGTGCAGG - Intronic
1073927518 10:108534127-108534149 TCGCTATGTTGGGGAAGTTCTGG - Intergenic
1074975332 10:118576529-118576551 TCCCCATCTGCTGGGAGTGCTGG + Intergenic
1075026700 10:118990169-118990191 TCCCAAAGTTGCGGGATTGCAGG + Intergenic
1076179633 10:128397168-128397190 TTCCCATGTTGGTGGAGATCCGG + Intergenic
1077001109 11:322757-322779 TCCCTGTGTTAAGGGAGTGCTGG + Intronic
1077430576 11:2514030-2514052 TCTCCATTTGGGGGGTGTGCAGG + Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081978915 11:47254151-47254173 GCCCCATCTTGTGGGAGTGGGGG - Intronic
1082701758 11:56441263-56441285 ACTCCTTGTTGGAGGAGTGCAGG + Intergenic
1084504915 11:69559488-69559510 TGCCCATTTTAGGGGAGTGTGGG - Intergenic
1084679187 11:70656139-70656161 GCCCCATGTTGTGGGAGTGAAGG + Intronic
1085322612 11:75583945-75583967 TCCCCATCTTGGGGTGGGGCAGG - Intergenic
1087032212 11:93717008-93717030 TCCCTATGTTGAAGGAGTGCTGG + Intronic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1088369897 11:109077620-109077642 TCCCCCTCTTGGCTGAGTGCTGG + Intergenic
1092676061 12:10922026-10922048 TCCCAATGTTCGGGGATTACAGG + Intronic
1092795327 12:12105639-12105661 TCCCAAAGTTGGGGGATTACAGG - Intronic
1095554111 12:43480788-43480810 TCCACATGCTGAGGGAGTGTGGG + Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097934000 12:65224764-65224786 TCCCCAGGTTTGGGGAGTTTTGG + Intronic
1102543929 12:113641346-113641368 TCCCCAAGATGGGGGACTGGGGG - Intergenic
1102555783 12:113725537-113725559 TCCTCATGCTGGTGGAGAGCTGG + Intergenic
1103270339 12:119668229-119668251 TGCCCATGATGGGGGTCTGCGGG - Exonic
1103340051 12:120216359-120216381 GCCCCATGATGAGGGGGTGCAGG - Intronic
1103380153 12:120487940-120487962 TCCCTATGTTGAGGGAGTACTGG + Intronic
1104899078 12:132178521-132178543 GCCCCATGTAAGGGGAGTGGGGG - Intergenic
1105449194 13:20483797-20483819 TCCCCATGTTCTGGGATCGCAGG + Intronic
1105935942 13:25099425-25099447 TCCCCATTTTGGGGGCCTGTAGG + Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108337790 13:49463826-49463848 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1109404146 13:61875595-61875617 TCGCTATGTTGAGGGAATGCTGG + Intergenic
1109487402 13:63045043-63045065 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1110514808 13:76397556-76397578 TGACAATGTTGGGGGAGTGGTGG - Intergenic
1112568384 13:100570513-100570535 CCCACATGTTGTGGGAGGGCAGG - Intronic
1115632613 14:35260406-35260428 TCCTTATGTTGAGGGAGTACTGG - Intronic
1116395984 14:44449209-44449231 TCCTTATGTTGAGGGAGTGTTGG + Intergenic
1118140273 14:63072756-63072778 AACCCATGCTGGGAGAGTGCTGG - Intronic
1118560046 14:67069272-67069294 TCCCCATGTTAGGAGAGTAGAGG - Intronic
1119436265 14:74599811-74599833 TGCCCATGCTCAGGGAGTGCTGG - Intronic
1119549898 14:75501265-75501287 TCCCCAACTTTGGGGAGTGCTGG + Intergenic
1119724360 14:76913335-76913357 TCCCCGGGGTGGGGGAGTGGGGG + Intergenic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1120457042 14:84744848-84744870 TACCCTTGTTGGGGGTGGGCTGG + Intergenic
1122130603 14:99602995-99603017 GCCCCACTTTGGGTGAGTGCGGG + Intronic
1122647539 14:103205378-103205400 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1122695107 14:103548621-103548643 CACCCATGTTGGGGGAGTCAGGG - Intergenic
1123218635 14:106836579-106836601 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123220007 14:106845812-106845834 TCCTTATGCTGAGGGAGTGCTGG + Intergenic
1125694251 15:41621959-41621981 TCGCCAAGCAGGGGGAGTGCTGG + Intronic
1125715395 15:41817115-41817137 TGCCCATTGTGGGGGAGTGTTGG + Intronic
1128292677 15:66490017-66490039 TCCCCATGAAGGGGGTGGGCTGG - Intronic
1128600568 15:68992161-68992183 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1129018260 15:72488982-72489004 TCCCAAAGTTGTGGGATTGCAGG - Intronic
1129981769 15:79878709-79878731 TCCCTATGTGGAGGGAGTGGTGG + Intronic
1130282771 15:82532304-82532326 TCAGCTTGTTGGGGGACTGCAGG + Intergenic
1130437079 15:83911539-83911561 TCCCCAGGATGGGGCAATGCTGG - Intronic
1130939343 15:88494790-88494812 GCCCCATCCAGGGGGAGTGCAGG - Intergenic
1131072936 15:89477304-89477326 TCCCCATGTTGTGGGTGGGAAGG - Intronic
1132674564 16:1116385-1116407 CCCCCATGGTGGGGCAGTCCTGG - Intergenic
1132697371 16:1207940-1207962 TCCCTAGGTTGGGGGATTCCTGG + Intronic
1133208854 16:4251437-4251459 TCCCAAAGTTGTGGGATTGCAGG - Intergenic
1133276182 16:4639657-4639679 TCCCCGTATTGGGGGTGTGGAGG + Intronic
1133348951 16:5088983-5089005 CCCCCATGGTGTGGGAGTGTGGG + Intronic
1134476691 16:14580226-14580248 TCCCAAAGTTGGGGGATTACAGG + Intronic
1137584495 16:49656108-49656130 GCCCCACGTTGGGGCAGTGTAGG + Intronic
1139751805 16:69113509-69113531 TCCCCAAGTAGGGGGAGTCGGGG + Exonic
1140488867 16:75317378-75317400 CTCCCATGGTGGGGGAGTCCTGG + Intronic
1142904470 17:3033017-3033039 GCCCCATGTGGGGAGAGGGCTGG - Intronic
1145008104 17:19349106-19349128 TACCACTGCTGGGGGAGTGCTGG - Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1146283020 17:31557699-31557721 TCGCCATTTTGTGGGAGCGCAGG - Intergenic
1148344504 17:46894550-46894572 TCCCCATGGGGCGGAAGTGCCGG + Intergenic
1149868265 17:60162363-60162385 TCCCCAGGGTGGGGGTCTGCTGG - Intronic
1150446497 17:65230690-65230712 AGTCCATGTTGGGGGAGTGCAGG + Intergenic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1152251144 17:79213288-79213310 TCCCCTTCCTGGGTGAGTGCAGG - Intronic
1152374615 17:79912785-79912807 TCCCCAACTCGGGGTAGTGCTGG - Intergenic
1203165616 17_GL000205v2_random:90264-90286 TCCCTGTGTTGGGGGAGTGTTGG + Intergenic
1153594317 18:6709091-6709113 TCCCCATTTTGGGAGAGTTATGG - Intergenic
1155732701 18:29180717-29180739 TCCGTATGTTGAGGGAATGCTGG + Intergenic
1155823518 18:30408708-30408730 TCCCTATGTTTAGGAAGTGCTGG - Intergenic
1158609861 18:58929287-58929309 TCCTCATTTTTGGGGATTGCTGG + Intronic
1159054777 18:63452762-63452784 TCCCTATGTTGAAGGAGTGCTGG - Intergenic
1160786263 19:901384-901406 TCCCCGTGTGGAGGGAGTGAGGG + Intronic
1161152030 19:2714633-2714655 ACCCCACGATGGGGGAGTGGGGG + Exonic
1161220001 19:3114068-3114090 TCCCGGTGCTGGGGGAGGGCCGG - Intronic
1161769849 19:6225269-6225291 TCCCCAGGCCGGGGGACTGCTGG - Intronic
1162095571 19:8307955-8307977 ACCCCATGCTGGGGGAGGGGAGG - Intronic
1162124178 19:8490439-8490461 TGACCGTGGTGGGGGAGTGCGGG - Intronic
1162402549 19:10454616-10454638 TCCCCAGGTTTGGGGAGTCATGG - Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164044060 19:21519279-21519301 TCCCTATGTTGAGGGAATGCTGG - Intronic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1165004107 19:32790150-32790172 TACCCATGTTGGGGTTGGGCTGG + Intronic
1165638722 19:37365635-37365657 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1165742233 19:38211220-38211242 TGGCCATTTTGGGGGAGTGAGGG - Intronic
1166888086 19:45973537-45973559 TCCTCATGGTGGGGGGGGGCGGG + Exonic
1167496281 19:49820597-49820619 TCTCTATGTTGAGGGAGTGCTGG + Intronic
925180156 2:1812387-1812409 TCCCCATGATGGGAGAGTGCTGG + Intronic
925536979 2:4928522-4928544 TCAGCATGTTGGGGAAGTGGTGG + Intergenic
927132717 2:20073982-20074004 TCCCTATGTTGAGGGAGGGCTGG - Intergenic
928097240 2:28412247-28412269 TCACCACGATGGGGGTGTGCAGG - Exonic
929204621 2:39276827-39276849 TCCCCATACTGGGGGAGAGGAGG + Intronic
932651349 2:73561334-73561356 TCCCTGTGTTGAAGGAGTGCTGG + Intronic
933083890 2:78030079-78030101 TCCTTATGTTGTGGGAGTGCTGG + Intergenic
933532744 2:83531092-83531114 TCCCTCTGTAGAGGGAGTGCTGG - Intergenic
936114112 2:109688406-109688428 TGCCCATGTCAGGGGACTGCAGG - Intergenic
937607181 2:123815156-123815178 TCCCAAAGTTCTGGGAGTGCTGG - Intergenic
937944152 2:127316112-127316134 TCCCAATGTCGTGGGATTGCAGG - Intronic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
941011048 2:160299680-160299702 TCCCCTTGCTGGGAGAGAGCAGG + Intronic
941074262 2:160989296-160989318 TCCCCAAGTCTGGGGAGAGCTGG - Intergenic
946270999 2:218594294-218594316 TCCCCAACTTGGGGGAGTAGTGG - Exonic
947567942 2:231207264-231207286 TCCCAAAGTTGTGGGATTGCAGG + Intronic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1168786663 20:545186-545208 TCCCCATGTGGGGTTAGGGCTGG + Intergenic
1168788639 20:561071-561093 TCCACATAATGAGGGAGTGCTGG - Intergenic
1168831487 20:847465-847487 TCCCCATGCTGAAGGAGTGATGG + Intronic
1169332118 20:4724383-4724405 TCCCCATGTTTGGGTTGTGCAGG - Intronic
1172042104 20:32052773-32052795 TCCCCTTCTTGGGGGGGGGCGGG + Intronic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1174782439 20:53402207-53402229 TTCCCCTGTAGTGGGAGTGCTGG + Intronic
1174980782 20:55392234-55392256 ACCCCATGTTGGTTGAGTTCTGG - Intergenic
1175039414 20:56032861-56032883 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1175379815 20:58554985-58555007 TCCCCATGAAGGGGGAGAGGTGG - Intergenic
1176335991 21:5600717-5600739 TCCCGATGTTGGGGGAGCGTTGG - Intergenic
1176378808 21:6101568-6101590 TCCCCATGCTGGGGAGGTGGGGG - Intergenic
1176391766 21:6220231-6220253 TCCCGATGTTGGGGGAGCGTTGG + Intergenic
1176406138 21:6368815-6368837 TCCCTGTGTTGGGGGAGTGTTGG - Intergenic
1176469653 21:7095943-7095965 TCCCGATGTTGGGGGAGCGTTGG - Intergenic
1176493214 21:7477721-7477743 TCCCGATGTTGGGGGAGCGTTGG - Intergenic
1176507428 21:7660662-7660684 TCCCGATGTTGGGGGAGCGTTGG + Intergenic
1176687636 21:9865287-9865309 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1178284678 21:31315636-31315658 TGCCCAGGCTGGAGGAGTGCAGG - Intronic
1178547579 21:33505854-33505876 TCGCCATTTTGGGTGGGTGCTGG - Intronic
1178677204 21:34641340-34641362 TTTCTATGTTGAGGGAGTGCTGG - Intergenic
1179345005 21:40547921-40547943 TCCCCAATTTGGGGGGCTGCGGG - Intronic
1179744666 21:43436669-43436691 TCCCCATGCTGGGGAGGTGGGGG + Intergenic
1180791213 22:18576717-18576739 TCCTGCTGTTGGGGGAGTGGGGG + Intergenic
1180894164 22:19316210-19316232 TCCTTATGTGGAGGGAGTGCTGG - Intergenic
1181230525 22:21418597-21418619 TCCTGCTGTTGGGGGAGTGGGGG - Intronic
1181248125 22:21516272-21516294 TCCTGCTGTTGGGGGAGTGGGGG + Intergenic
1183025484 22:35062963-35062985 TCCCAATGTTGGAGGATTGGAGG - Intergenic
1183524228 22:38314314-38314336 TCCCCAGGTGTGTGGAGTGCAGG - Intronic
1184302577 22:43570895-43570917 GCTCCATGGTGGGGGAGTCCAGG - Intronic
1185128491 22:49024736-49024758 GCCCCAGGTTGGGGCAGAGCAGG + Intergenic
949534236 3:4983460-4983482 TGCCCATGCTGGAGAAGTGCTGG + Exonic
949927061 3:9049742-9049764 TGCCCATCTTGGGAGAGTGGTGG + Intronic
950102319 3:10365463-10365485 TCCCCAGAGTGGGGGAGGGCAGG + Intronic
950216336 3:11162345-11162367 TCTCCTTGGTGGGGGAGTGCGGG + Intronic
950354063 3:12388695-12388717 TCCCCAGGTAGGGGAAGAGCAGG - Intronic
951087259 3:18528006-18528028 TCCCCTTGCTGTGGGACTGCTGG + Intergenic
953980353 3:47410336-47410358 TCCCTATGTGGGGGTAGGGCCGG + Exonic
959913843 3:111794312-111794334 TCTGCATGTTGGGGGAGAGAGGG - Intronic
959961255 3:112302004-112302026 TCCCTGTGTTGAGGGGGTGCTGG - Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
959962313 3:112312426-112312448 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
960683168 3:120270217-120270239 TCCCCATGTCTGGGGAGACCAGG - Intronic
961511071 3:127404088-127404110 TCCCCAGGTTGGGGAAGTGATGG - Intergenic
965698485 3:171435331-171435353 CCCCCATGCTGGGGAAGTGGAGG + Intronic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
966209300 3:177436159-177436181 TCCCCATGTTGGCCAAGTGTTGG - Intergenic
968088164 3:195883529-195883551 TCCCCTTCCTGGGGGAATGCCGG + Intronic
969298314 4:6282284-6282306 TCCCCATGTGGGGGATGCGCCGG + Intronic
969833980 4:9823910-9823932 TGCTTATGTTGGGGGAGTGAAGG + Intronic
971278853 4:25224407-25224429 TCCTTATGTTGAGGGAGTGCTGG + Intronic
972651754 4:41024631-41024653 TCCCTATGTTGAAGGAGGGCTGG - Intronic
975048777 4:69832919-69832941 TCTCTATATTGAGGGAGTGCTGG + Intronic
975894992 4:79078472-79078494 TTCCCATGTTGAGGCAGTTCTGG + Intergenic
978533346 4:109736183-109736205 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
980350988 4:131683103-131683125 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
982228535 4:153187508-153187530 TCCGCAGGTTAGAGGAGTGCAGG + Intronic
982819281 4:159926446-159926468 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
989302671 5:39912351-39912373 TCCCCATGGTTGGGGGGTGGGGG + Intergenic
992625165 5:78630259-78630281 GCCCCATGCAGGGAGAGTGCCGG - Intronic
993516411 5:88841249-88841271 TCCCAAAGTTCAGGGAGTGCAGG - Intronic
998420444 5:141980330-141980352 TCCCCATGTAAGGTGACTGCAGG + Exonic
1002081191 5:176738452-176738474 TCCCCATGGTGAGGGTGTGAGGG + Intergenic
1002761820 6:208393-208415 TCCCCATGTTGTGTGAGAGCAGG - Intergenic
1003213976 6:4091954-4091976 TCGCTATGTTGAGGGAGTGCTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1005691794 6:28313557-28313579 TCCCCATCTTGGGGGAGAACAGG + Intergenic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007410820 6:41660302-41660324 TCCCCTTGGTGGGTGAGGGCAGG - Intergenic
1015806968 6:137119458-137119480 TCCCAAGGTTGAGGGAGTGCTGG - Intergenic
1015939383 6:138432744-138432766 TCCACATCTTGGGGGTGGGCTGG + Exonic
1019351827 7:557621-557643 CGCCCATGTCGTGGGAGTGCTGG - Intronic
1020388740 7:7635713-7635735 GCACCATGTTGGGGGTGAGCAGG - Intergenic
1020862078 7:13506154-13506176 TCTTCATTTTGGGGGAGTGGAGG + Intergenic
1021906841 7:25342927-25342949 TCCTCATGTTGGAGGTGTGGTGG + Intergenic
1022674064 7:32481929-32481951 TCCGTATGTTGAGGGAATGCTGG - Intergenic
1024423614 7:49199979-49200001 TCTGTATGTTGAGGGAGTGCTGG - Intergenic
1024670814 7:51592715-51592737 TACCCATTTTGGGGTAGTGCAGG + Intergenic
1027403176 7:77829952-77829974 TGTGCATGTTGGGGGAGTACAGG + Intronic
1029099523 7:98117116-98117138 TCCCCATGGTGTACGAGTGCAGG + Intronic
1029491401 7:100872425-100872447 TCCCAAAGTCGGGGGATTGCAGG + Intronic
1031567380 7:123317673-123317695 TCCCCATGATAGGGGATTGTAGG - Intergenic
1032352150 7:131174592-131174614 TCCACATGTTGGGAGAAGGCAGG + Intronic
1032605660 7:133348641-133348663 TCAGCATGTTTGGGGACTGCGGG - Intronic
1032670497 7:134077950-134077972 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1032871495 7:135990905-135990927 TTTCCATGTTGATGGAGTGCAGG - Intergenic
1033106294 7:138528335-138528357 TCCCCATGTTGGGGGAGTGCTGG + Intronic
1033213178 7:139475552-139475574 TCCCCGTGCTGGGGGGGTGGCGG + Intronic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1034971038 7:155419226-155419248 TCCCCATGTCGGTGGAAGGCTGG + Intergenic
1035075988 7:156177913-156177935 TCCCCACTTTGGGAGAGGGCTGG + Intergenic
1035728317 8:1838434-1838456 TCCCCAGGCTGGGCGGGTGCCGG - Intronic
1039500578 8:38013574-38013596 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1039839200 8:41281363-41281385 CCCCCATGCTGAGGGAGTGAGGG - Intronic
1040063497 8:43125013-43125035 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1041400856 8:57443210-57443232 TCCCTATGTTGCCAGAGTGCTGG + Intergenic
1041507350 8:58614285-58614307 TCCCTATGTTAAAGGAGTGCTGG - Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1044587828 8:93884459-93884481 TACCCATCTTGGGGGAGAGCTGG - Intronic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1047398826 8:124528798-124528820 TCCTTATGTTGAGGGAGTGCTGG - Intronic
1048204101 8:132401833-132401855 TCCCCACGTCAGGGCAGTGCTGG - Intronic
1049047844 8:140166628-140166650 TCCTCATGCTGGAGGAGTGGAGG - Intronic
1053414928 9:37941500-37941522 TCCCTCTGTTGGGGGAGTCATGG + Intronic
1053781720 9:41616612-41616634 TCCCTATGTTGAGGGAGCGCTGG + Intergenic
1054169668 9:61826766-61826788 TCCCTATGTTGAGGGAGCCCTGG + Intergenic
1054667870 9:67754049-67754071 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1056578648 9:87874182-87874204 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1059325446 9:113501516-113501538 TCCCGCTGCTGGGGGAGAGCTGG + Intronic
1060097519 9:120805362-120805384 TCCTGATGTTGAGGGAGTGCTGG + Intergenic
1061059527 9:128243560-128243582 CCCCCATGGTGGGGGAGGCCAGG - Intronic
1203425647 Un_GL000195v1:34185-34207 TCCCGATGTTGGGGGAGCGTTGG + Intergenic
1185547986 X:961142-961164 TCCCCAAGTTGGGAGAGTTCAGG - Intergenic
1185673119 X:1827078-1827100 CCCCAGTGTTGGGGGGGTGCTGG - Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1190535046 X:51417646-51417668 TCCTTACGTTGAGGGAGTGCTGG + Intergenic
1190714398 X:53091568-53091590 TCCCCCAGTTGGGGGTGTGCAGG + Intergenic
1191645369 X:63474910-63474932 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1194888549 X:99348890-99348912 TCCCCATGTTGGGGAACTTTTGG + Intergenic
1196457703 X:115901720-115901742 TCACCGTGTTGGGGCAGTGAAGG + Intergenic
1196755666 X:119155301-119155323 TACAAATGTTGGGGGAGGGCTGG - Intergenic
1197360224 X:125492637-125492659 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
1199440077 X:147857822-147857844 TCCCAATGTTGAGGGAGACCCGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201146783 Y:11069081-11069103 TTCCCATGCTGGAAGAGTGCTGG - Intergenic
1201147566 Y:11073206-11073228 TCTCCATGTTGAGGGCGTGGCGG - Intergenic
1201428291 Y:13878603-13878625 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1202026255 Y:20527194-20527216 TCCCCAAGTTCTGGGAGTACAGG - Intergenic