ID: 1033109924

View in Genome Browser
Species Human (GRCh38)
Location 7:138564682-138564704
Sequence ATGTATTTAAGGTGGTGATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 3, 2: 13, 3: 41, 4: 245}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033109924_1033109934 14 Left 1033109924 7:138564682-138564704 CCCAATCACCACCTTAAATACAT 0: 1
1: 3
2: 13
3: 41
4: 245
Right 1033109934 7:138564719-138564741 CTATCTGTGGTTCCTTTGGCTGG No data
1033109924_1033109929 1 Left 1033109924 7:138564682-138564704 CCCAATCACCACCTTAAATACAT 0: 1
1: 3
2: 13
3: 41
4: 245
Right 1033109929 7:138564706-138564728 GCCAATTGTTTCCCTATCTGTGG 0: 1
1: 1
2: 2
3: 11
4: 129
1033109924_1033109931 10 Left 1033109924 7:138564682-138564704 CCCAATCACCACCTTAAATACAT 0: 1
1: 3
2: 13
3: 41
4: 245
Right 1033109931 7:138564715-138564737 TTCCCTATCTGTGGTTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033109924 Original CRISPR ATGTATTTAAGGTGGTGATT GGG (reversed) Intronic
901987320 1:13086265-13086287 GTGTATTTAAGGTGGTGACAGGG + Intergenic
901994492 1:13140502-13140524 GTGTATTTAAGGTGGTGACAGGG - Intergenic
902863912 1:19265178-19265200 ATATATTTAAGGTGCTGTTTGGG + Intergenic
903818543 1:26083152-26083174 AGGTATATAAGGTTGTGATGGGG + Intergenic
905061739 1:35145659-35145681 ATGTATTTAAGGTGGTGACAGGG - Intergenic
905964426 1:42080371-42080393 ATGTATCTATGGTGTTGATTGGG + Intergenic
906418125 1:45638766-45638788 ATTTATTTAAAATAGTGATTGGG - Intronic
906909594 1:49933746-49933768 ATGTATTTGTGATGGTCATTAGG - Intronic
908076017 1:60518703-60518725 ATTTATGTCAGGTGGTGATATGG - Intergenic
908422943 1:63977250-63977272 ATGTGTGTAAGGTGTTGATATGG - Intronic
908930796 1:69314556-69314578 ATGTATTTATGGTGTTGGTTGGG + Intergenic
909091606 1:71232897-71232919 ATTTATTTAAGGACCTGATTGGG - Intergenic
909791937 1:79690890-79690912 AAGTATTTGAGGTGATGAATAGG - Intergenic
911743909 1:101418253-101418275 GTGTATTGAAGGTGCTGATTTGG + Intergenic
916103083 1:161409560-161409582 ATGTATTTAAGGTGGTGACAGGG - Intergenic
916145644 1:161736586-161736608 ATCCATTTAAGGTGTTGACTTGG - Intergenic
918162700 1:181915986-181916008 ATATATTTTAGGGGGTGATATGG + Intergenic
918743178 1:188163060-188163082 AGGTATTTAAGATTGTGATTTGG + Intergenic
919066192 1:192695037-192695059 TTGTATTTTAGGTGGAGATGGGG - Intergenic
919374292 1:196773748-196773770 ATGTTTTTAAAGTTGTGTTTTGG - Intergenic
919376736 1:196804234-196804256 ATGAATTCAAGGTGAAGATTAGG - Intergenic
919386442 1:196929114-196929136 ATGAATTCAAGGTGAAGATTAGG - Intronic
924515967 1:244766488-244766510 ATATATTTAAAGTGCTGAATAGG - Intergenic
1063760752 10:9072677-9072699 AAGTCTTTAAGGTGGTGATCGGG - Intergenic
1065600762 10:27365944-27365966 TTGCATTTAAGGTTGGGATTTGG + Intergenic
1065629751 10:27666410-27666432 AGCTATTTAAGAGGGTGATTGGG + Intergenic
1065663106 10:28026516-28026538 AGGGATTTAGGGAGGTGATTAGG + Intergenic
1065718862 10:28604866-28604888 TTATATTTAAAGTGTTGATTGGG - Intronic
1066615804 10:37293459-37293481 ATGTGTTTTAGGTTGTGATTTGG - Intronic
1067134433 10:43595537-43595559 ATGTATTTAAGGTGGTGACAGGG - Intergenic
1068249263 10:54415921-54415943 GTGAATTTAAGGAGGTGAATAGG + Intronic
1068695705 10:59966036-59966058 ATGCTTTTTAGGTGCTGATTGGG + Intergenic
1069715507 10:70518563-70518585 ATCTATTTAATGTGCTTATTTGG + Intronic
1072014566 10:91334192-91334214 CTGTATTTAAAGTGGAGGTTTGG - Intergenic
1073020908 10:100442975-100442997 TTGTCTTGAAGGTGGTGGTTGGG - Intergenic
1073964266 10:108970367-108970389 ATGTCTGTAAGGTGCGGATTGGG - Intergenic
1075503439 10:122999654-122999676 AGGTAGTAGAGGTGGTGATTTGG - Intronic
1077773958 11:5250961-5250983 AAGTATTTATGGTGGTTTTTTGG + Intronic
1077831847 11:5881108-5881130 GTTTATTTAAGGTGGTGGGTGGG + Intronic
1078368996 11:10729628-10729650 ATATCTTTAATGTGGTGATAAGG - Intergenic
1079423760 11:20319688-20319710 ATCTATTTAACCTGGGGATTTGG + Intergenic
1080317962 11:30971121-30971143 ATGTATTTACGGTGTTGGTTGGG - Intronic
1080683707 11:34498312-34498334 ATGTAATTAAAGTGGTGACACGG - Intronic
1080892494 11:36421486-36421508 GTTTATTTAAGGTGCTGATCTGG + Intronic
1084389987 11:68869030-68869052 ATGTATTTAAGGTGGTGACAAGG + Intergenic
1087188321 11:95226417-95226439 ATTTATTTAGGGTGGGGAGTTGG + Intronic
1087237036 11:95731558-95731580 ATGCAAGTAAGGTGGTGATTAGG - Intergenic
1087530659 11:99376991-99377013 ATGTACTTAACATGGTGTTTGGG + Intronic
1088219800 11:107557479-107557501 ATTAGGTTAAGGTGGTGATTAGG + Intronic
1090396600 11:126423514-126423536 ATTTATTTCAGGTGGTGACTAGG + Exonic
1090527394 11:127552171-127552193 ATGCATCTGTGGTGGTGATTTGG + Intergenic
1091474720 12:761277-761299 ATGTATTTAATATGGTAATTTGG - Intronic
1092427667 12:8387407-8387429 ATGTGTTTATGGTGGGGATGTGG - Intergenic
1093092040 12:14932647-14932669 ATGTATTTAAGATAGAAATTTGG - Intronic
1093622278 12:21306244-21306266 ATGGATTTATGCTGATGATTTGG - Intronic
1095484728 12:42673135-42673157 ATGCAGTTTAGGTGGTGAATAGG + Intergenic
1096916120 12:55035335-55035357 GTGTATGTAAGGTGGTGAAATGG - Intergenic
1098678408 12:73319965-73319987 ATTTAAATAAGGTGGTCATTTGG + Intergenic
1099473208 12:83075589-83075611 ATGTATTTGAGGAGCTAATTTGG - Intronic
1100025281 12:90121234-90121256 ATGTATCTATGGTGTTGGTTGGG + Intergenic
1106723187 13:32456344-32456366 ATGTATCTATGGTGTTGGTTGGG - Intronic
1108399573 13:50026213-50026235 ATGTATTTAAGGTGATATTTAGG - Intergenic
1108866517 13:54930431-54930453 ATGTAGTTAAGGTAGGGATCAGG + Intergenic
1109282829 13:60376869-60376891 ATGTATTTAATGTGGTTTGTAGG - Intergenic
1109427917 13:62191993-62192015 AAGTATTTGAGGTGATGAATAGG + Intergenic
1109898339 13:68725503-68725525 ATCTATTAAATGAGGTGATTGGG - Intergenic
1110190433 13:72724108-72724130 ATGTAATTAACGGGGTGAATGGG + Intronic
1110608934 13:77467071-77467093 CAATATTTAAGATGGTGATTGGG + Intergenic
1111167581 13:84480397-84480419 AAGGACTTAAGGTGGTGAGTAGG - Intergenic
1112366723 13:98761679-98761701 ATGTATTTAAGGTGGTGACAGGG + Intergenic
1113502921 13:110792740-110792762 AGGTGTTTAGGGTGGTGGTTTGG + Intergenic
1114512491 14:23274449-23274471 ATTTATTGGAGGTGGTAATTAGG - Exonic
1114573738 14:23694162-23694184 GTGCATTTAAGGTGGTGACAGGG + Intergenic
1114688767 14:24560664-24560686 AAGTATTCAAGCTGGTGGTTGGG + Intergenic
1115061159 14:29191959-29191981 TAGTATTTAAGGTGGGGAGTTGG + Intergenic
1117744845 14:58859627-58859649 ATGTATGTATGGTGTTGATTGGG + Intergenic
1119232291 14:72990230-72990252 ATTTGTTTAAGCTTGTGATTTGG - Intronic
1120423484 14:84316859-84316881 ATGTATCTATGGTGTTGGTTGGG - Intergenic
1123538689 15:21263786-21263808 ATAAATTTTAGGTGATGATTAGG + Intergenic
1123538788 15:21265372-21265394 ATAAATTTTAGGTGATGATTAGG - Intergenic
1123835609 15:24188739-24188761 ATATATTTAAGTTGCTGAATGGG - Intergenic
1125004122 15:34799087-34799109 AGGTATTTTTGGTGGTGGTTGGG - Intergenic
1125871609 15:43107064-43107086 ATGTATTTATTGTGGTTGTTGGG - Intronic
1126661536 15:51038155-51038177 ATGTATCTATGGTGTTGATTGGG + Intergenic
1127245702 15:57171488-57171510 ATGGTTTTAATGTGGTGTTTGGG - Intronic
1127410248 15:58697987-58698009 ATGTGTTTATGATGTTGATTGGG - Intronic
1128541240 15:68535081-68535103 ATCTAAATAAGGTGGTGATATGG - Intergenic
1129337223 15:74859926-74859948 ATTTATTTAATGTGTTTATTTGG - Intronic
1130404572 15:83586547-83586569 ATGTACTTAATGTCTTGATTTGG + Intronic
1131636572 15:94239107-94239129 CTTTTTTTAAGGTGGTGGTTGGG + Intronic
1131772291 15:95751647-95751669 ATGTAATTAATGTGGTGAAATGG - Intergenic
1131893379 15:96999094-96999116 ATGTATTTAATGTGGTGAATTGG + Intergenic
1133889838 16:9868566-9868588 AGGTATTTAAAGTGACGATTTGG - Intronic
1136098725 16:27977722-27977744 AGGTATTGAAGCTGGTGATGGGG - Intronic
1137320479 16:47376124-47376146 ATGTATTTAACGAGGATATTTGG + Intronic
1137955629 16:52825964-52825986 AAGGATTTCAGGTGGTGATGAGG - Intergenic
1140768464 16:78181590-78181612 AGGAATTTAGGGTGGTAATTTGG + Intronic
1145187734 17:20810120-20810142 AGGCCTTCAAGGTGGTGATTAGG + Intergenic
1146851244 17:36223495-36223517 AGGCTTTCAAGGTGGTGATTAGG - Intronic
1146851467 17:36225471-36225493 AGGCCTTCAAGGTGGTGATTAGG - Intronic
1146867158 17:36347362-36347384 AGGCTTTCAAGGTGGTGATTAGG - Intronic
1146867374 17:36349344-36349366 AGGCCTTCAAGGTGGTGATTAGG - Intronic
1147070031 17:37947971-37947993 AGGCTTTCAAGGTGGTGATTAGG - Intergenic
1147070251 17:37949955-37949977 AGGCCTTCAAGGTGGTGATTAGG - Intergenic
1147081552 17:38027491-38027513 AGGCTTTCAAGGTGGTGATTAGG - Intronic
1147081774 17:38029481-38029503 AGGCCTTCAAGGTGGTGATTAGG - Intronic
1147097503 17:38151466-38151488 AGGCTTTCAAGGTGGTGATTAGG - Intergenic
1147097723 17:38153451-38153473 AGGCCTTCAAGGTGGTGATTAGG - Intergenic
1148999955 17:51747320-51747342 ATATATATAAGGTGAGGATTTGG + Intronic
1149616212 17:58002395-58002417 TTGAATTTAAGGTGATTATTTGG - Intronic
1149619629 17:58033693-58033715 ATGAATTTTAGGTGGTGCTGTGG - Intergenic
1150079209 17:62221589-62221611 AGGCCTTCAAGGTGGTGATTAGG - Intergenic
1150079421 17:62223577-62223599 AGGCCTTCAAGGTGGTGATTAGG - Intergenic
1150839469 17:68594558-68594580 CTGAATTTAAGGTGGTGTCTAGG + Intronic
1151377265 17:73698424-73698446 AGGTCTTTAAAGGGGTGATTAGG + Intergenic
1153104343 18:1510371-1510393 ATGTATTTATAGTGTTGGTTGGG + Intergenic
1155247376 18:23923425-23923447 ATATATTTAGGATGGTGAATGGG + Intronic
1155388777 18:25310916-25310938 ATGAATTTAAGTAGGTTATTGGG - Intronic
1157440905 18:47710966-47710988 ATGTATTTGAGGTGGGGTTGGGG - Intergenic
1162002994 19:7759889-7759911 ATGTATCTATGGTGTTGGTTGGG + Intergenic
1163231030 19:16002334-16002356 GTGTATTTAGGGTGGTGACAGGG - Intergenic
1163953472 19:20612700-20612722 ATGTATTTAGGGTGGTGACAGGG + Intronic
1164148255 19:22526400-22526422 ATATATTTAAGGTGGTGACAGGG + Intronic
1164286669 19:23823045-23823067 ATGTATTTAAGGTGGTAACTGGG - Intronic
1165583799 19:36894264-36894286 ATGTATTTATAGTGTTGGTTGGG - Intronic
1166147492 19:40847674-40847696 ATGTGTTTAAGGTGTTGGTTAGG + Intronic
1166151638 19:40879559-40879581 GTGTGTTTAAGGTGTTGGTTAGG + Intronic
1167520875 19:49954008-49954030 ATGTATTAAAGATGGTGATAGGG + Intronic
925785391 2:7427535-7427557 CTGTAATTAAGGTGTTGCTTGGG + Intergenic
926392280 2:12405604-12405626 AGGTAATTAAGGTGGTCATAAGG + Intergenic
928134815 2:28680248-28680270 ATATATTTAAGGTAGAGATGGGG - Intergenic
928167486 2:28981565-28981587 ATCTATTGTAGGTGGTGAATGGG + Intronic
928714153 2:34041011-34041033 ATGTATTTTAGGTTGTGGTCAGG + Intergenic
928797773 2:35043821-35043843 ATATATTTTATGTGGTGTTTTGG + Intergenic
929256313 2:39814928-39814950 ATGTATGTAAGGGTGTGTTTTGG + Intergenic
930565301 2:53011361-53011383 ATGTTTTTAATGGGGTTATTTGG + Intergenic
931494517 2:62787938-62787960 AACTCTTTAAGGTTGTGATTTGG + Intronic
932618297 2:73250163-73250185 ATGTCTATAAGGTTGGGATTGGG + Intronic
937412114 2:121685659-121685681 ATGTATTTAAGGTGGTGACAGGG - Intergenic
938822583 2:134974873-134974895 ATGTATCTATGGTGTTGATTGGG + Intronic
939282468 2:140082010-140082032 ACCTATTTAGGGTGGTGTTTAGG - Intergenic
939721915 2:145664110-145664132 TTATTTTTAAGGTGGTGAGTAGG - Intergenic
940557980 2:155256719-155256741 ATGTATTAATGGTGTTGGTTGGG + Intergenic
940696049 2:156979766-156979788 ATATTTTTAAGTTGGTGTTTTGG + Intergenic
941396033 2:164974031-164974053 ATACATTTTAGGTGATGATTAGG - Intergenic
944022476 2:195123653-195123675 ATGTATTTAATGTAATGATAAGG - Intergenic
944048692 2:195441130-195441152 ATGTATCTATGGTGTTGGTTGGG - Intergenic
944617032 2:201471407-201471429 GAGGATTTAAGGTGGAGATTTGG + Intronic
945407920 2:209472290-209472312 AAGGATTTAAGTTGGTGACTAGG + Intronic
946730070 2:222701035-222701057 ATTTAGCTAAGGTGATGATTTGG - Intronic
947043522 2:225950390-225950412 ATGTATCTATGGTGTTGATTGGG - Intergenic
948812813 2:240493503-240493525 ATGCATTTATGGTGTTGGTTGGG + Intronic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1173029717 20:39343494-39343516 ATAGATTTAAGGTGATGTTTAGG + Intergenic
1173049977 20:39549986-39550008 AAGGATTGAAGATGGTGATTAGG + Intergenic
1179087230 21:38228478-38228500 ATGTATTTAAGGTGGTGACTGGG - Intronic
1183758921 22:39798412-39798434 ATGTATCTATGGTGTTGGTTGGG + Intronic
1184702042 22:46181686-46181708 ATATATTTAGGGTAGTGACTGGG + Intronic
949092343 3:43145-43167 ATGTATGTAAGATGGAGCTTTGG + Intergenic
949130554 3:495329-495351 TTGTATTTTTGGTGGAGATTGGG + Intergenic
949261551 3:2107548-2107570 AAGTGTTAAGGGTGGTGATTGGG - Intronic
950724942 3:14911159-14911181 AGATATTTAAGGTGGGGATGTGG - Intronic
952664652 3:35889689-35889711 ATGTTTTTAATGTCATGATTAGG + Intergenic
953670403 3:44957540-44957562 ATGGATTTAGGTTGGTGATGTGG - Intronic
954965801 3:54609813-54609835 AAGTTTTGTAGGTGGTGATTTGG + Intronic
955425049 3:58778930-58778952 ATGTATCTATGGTGTTGGTTGGG - Intronic
956879850 3:73499473-73499495 ATATGTTTTAGGTGGTGAGTTGG - Intronic
957032603 3:75259082-75259104 ATGTATGTAAGATGGAGCTTTGG + Intergenic
958093471 3:88908107-88908129 ATGAATATAATGTGATGATTTGG - Intergenic
959471798 3:106761686-106761708 ATGTTTTAATGATGGTGATTAGG + Intergenic
959751991 3:109849202-109849224 ATGTATTTATGGTGTTTATATGG + Intergenic
961716127 3:128858677-128858699 ATGTATATCGGGTGGTGACTAGG - Intergenic
963522481 3:146372887-146372909 ATGTTTCTCAGGTGGTGAGTAGG + Intergenic
963758510 3:149260134-149260156 ATGTATTTATAGTGTGGATTGGG - Intergenic
965944718 3:174226110-174226132 ATGTATTCAAAGAGATGATTAGG + Intronic
966261099 3:177980490-177980512 TTGTATTTTAAGTGGTGACTTGG + Intergenic
967775316 3:193380461-193380483 GTGTATTTAATGTGGTGTTTAGG - Intergenic
969646857 4:8435580-8435602 ATGTATTTAAGGTGGTGACAGGG + Intronic
969797186 4:9535483-9535505 ATGTGTTTATGGTGGGGATGTGG + Intergenic
970340064 4:15096877-15096899 AGGTATTTGGGGAGGTGATTAGG + Intergenic
970546253 4:17133400-17133422 AGGTATTTAAAGAGATGATTAGG - Intergenic
970900508 4:21153086-21153108 ATGTGTTTAAGGAGTTAATTAGG - Intronic
971979956 4:33739231-33739253 ATGTTTTAAATGTGGTGAATAGG - Intergenic
972479663 4:39485545-39485567 ATGTATTTAGGGTAGTAACTGGG + Intergenic
973599942 4:52532059-52532081 ATGTATTCAAGATGATGAATTGG - Intergenic
973972798 4:56230329-56230351 ATGAATCTTGGGTGGTGATTTGG + Intronic
975184033 4:71380365-71380387 AAGTATTTATGGTAGTCATTAGG + Intronic
976295969 4:83472731-83472753 ATGTATTTTAGGAGGTGGCTGGG + Intronic
977269844 4:94903680-94903702 GTGTCTTTAAGGAGGTGATTGGG + Intronic
979057647 4:116016283-116016305 ATGTATTTAAGGTGGTGACTGGG + Intergenic
979346750 4:119596224-119596246 ATGTAATTATGGTTGTGATTAGG - Intronic
980457792 4:133068673-133068695 ATGTATCTATGGTGTTGATGAGG + Intergenic
980746571 4:137025357-137025379 ATGTAGTTAAGTTTGTAATTTGG + Intergenic
981585792 4:146300793-146300815 ATGTTTTTCAGGTGATGACTAGG + Intronic
982939580 4:161532767-161532789 ATGTATATTCTGTGGTGATTCGG - Intronic
984009242 4:174350550-174350572 ATGAATTTAATTTGGTGCTTTGG - Intergenic
985397358 4:189558033-189558055 ATTTATTGAGGGAGGTGATTTGG - Intergenic
986543915 5:8874614-8874636 ATGTATTAAATGTGGTCAGTGGG + Intergenic
986634681 5:9809725-9809747 ATGTAATCAAGGTGGTGATGTGG - Intergenic
986873883 5:12082053-12082075 ATGTATTTATGGTGTTCATTGGG - Intergenic
987417157 5:17674342-17674364 AGGTCTTTAGGTTGGTGATTAGG - Intergenic
987713826 5:21539877-21539899 ATATATTTTTGGTGGTGCTTTGG - Intergenic
988029168 5:25739844-25739866 ATGTATCTATGGTGCTGGTTGGG - Intergenic
989068680 5:37488967-37488989 ATGTATCTATGGTGTTGGTTAGG + Intronic
989206899 5:38818648-38818670 CTGTATTTTAGGAGGAGATTTGG - Intergenic
989231124 5:39087080-39087102 ATGTATCTATGGTGTTGGTTGGG - Intergenic
990170927 5:53048858-53048880 ATGCATTTAAAATGGGGATTTGG - Intronic
990749446 5:58997957-58997979 ATATATTTAAGGAGGTGGTATGG + Intronic
991275589 5:64842772-64842794 TTGTATTTTAGGTGGAGATGGGG + Intronic
993101732 5:83548673-83548695 GTGTATTTTAGGTGGTTAATGGG + Intronic
993264114 5:85699531-85699553 TTGTATTTTAGATGGAGATTGGG + Intergenic
993320196 5:86461326-86461348 ATGTATTTAAGGTGGTGACAGGG + Intergenic
993424747 5:87749177-87749199 ATGTCTCTGAGGTAGTGATTGGG - Intergenic
994902430 5:105792631-105792653 ATATATTTTAGGGGGTGATGGGG - Intergenic
994909581 5:105885431-105885453 ATGTATTTAAGGTGCTTAGTAGG + Intergenic
996069609 5:119120051-119120073 TTGTATTTAAAGTGGAGATGGGG + Intronic
996205380 5:120728550-120728572 ATGAATATAAGGGGGTGATTAGG + Intergenic
996332347 5:122344095-122344117 ATGAATTTCAGGTGGAGATGGGG - Intronic
999108485 5:149094351-149094373 ATGTATCTATGGTGTTGGTTGGG - Intergenic
999199981 5:149809102-149809124 ATCTATCTAAGGTGGAGATAGGG - Intronic
1000041273 5:157486863-157486885 AGGTCTTTAAAGAGGTGATTAGG + Intronic
1000943318 5:167390161-167390183 ATGTATTTACGGAGTTGATTTGG + Intronic
1002861380 6:1082536-1082558 ATTTACTTACGGTGGTGTTTTGG - Intergenic
1002976220 6:2080489-2080511 ATGTATCTATGGTGTTGGTTGGG + Intronic
1004503697 6:16230513-16230535 ATGCATTTAAGGTGGTAACAGGG - Intergenic
1004788429 6:18996095-18996117 ATGTATTTAAGGTGTTTTTGTGG + Intergenic
1005164311 6:22901989-22902011 ATTTACTTCAGGTGGTTATTTGG - Intergenic
1005665709 6:28051929-28051951 ATGTATTTAAGGGAGTGTCTTGG - Intergenic
1005665943 6:28055007-28055029 ATGTATTTAAGGGAGTGTCTTGG - Intergenic
1005798139 6:29390384-29390406 ATGTATCTAAGGTGTAGTTTGGG + Intronic
1007189058 6:39998047-39998069 ATGTATTTAGGGTGGTAAGTGGG - Intergenic
1009002893 6:57742017-57742039 ATATATTTTTGGTGGTGCTTTGG + Intergenic
1009428226 6:63538136-63538158 AAGTTTTCATGGTGGTGATTAGG - Intronic
1009673762 6:66789138-66789160 ATGTATTTATAGTGTTGGTTGGG - Intergenic
1009783709 6:68303040-68303062 ATGTGTTTAATTTGGTGATTTGG + Intergenic
1010051987 6:71515926-71515948 ATGTCTTTAAAGTTGTGATAAGG - Intergenic
1010249360 6:73692212-73692234 CTGTCTTTAAGGTGTTGATATGG - Intergenic
1011026251 6:82872687-82872709 ATTTATTCCAGGTGGTGTTTAGG - Intergenic
1011300295 6:85866251-85866273 ATGTATTTAAGGTGGTGGCAGGG - Intergenic
1011569631 6:88721201-88721223 TTGGATTTAAGGTAGAGATTTGG - Intronic
1011777897 6:90752498-90752520 ATGTTTTTAAGTTGGTGGGTGGG + Intergenic
1011862546 6:91777945-91777967 ATGTATTGATGGTGGTTATGAGG + Intergenic
1012006269 6:93716585-93716607 AGGTATTCAAGGTGGTGATGGGG + Intergenic
1014282244 6:119454735-119454757 ATATATTCAAAGTGGTGAATAGG + Intergenic
1014615927 6:123599628-123599650 ATTTCTGTAAGGTGGTTATTTGG + Intronic
1014696954 6:124634065-124634087 ATGTATCTATGGTGTTCATTGGG - Intronic
1015808111 6:137132930-137132952 AGGTGTTCAAGGTGGTGATGAGG - Intergenic
1017632369 6:156408929-156408951 CTCTATTTAGGGTGATGATTGGG + Intergenic
1017974102 6:159338936-159338958 ATGTATCTATGGTGTTGGTTTGG - Intergenic
1018209047 6:161462374-161462396 AGGTATTTTAGGAGCTGATTTGG + Intronic
1022814639 7:33903131-33903153 ATGTTTTTAAGGTGGTTTTTGGG + Intergenic
1025824334 7:64998389-64998411 GTGTATTTAAGGTGGTGACTGGG - Intronic
1026658305 7:72276437-72276459 AGGTCTTTCAGGAGGTGATTAGG + Intronic
1028542672 7:91960906-91960928 ATATATTTAAGGAGGTGGTATGG - Intronic
1030868922 7:114732597-114732619 ATGTATCTATGGTGTTGGTTGGG + Intergenic
1031300988 7:120060572-120060594 ATGTATTTAAGGTGGTGACTTGG - Intergenic
1033109924 7:138564682-138564704 ATGTATTTAAGGTGGTGATTGGG - Intronic
1033363837 7:140656567-140656589 GTGTATTTAGGGTGGTGACAGGG + Intronic
1034000293 7:147404374-147404396 ATATGTTTAAGTTGGGGATTAGG - Intronic
1034741722 7:153479652-153479674 TTGTATTTATGGTGTTGTTTTGG - Intergenic
1034854406 7:154528494-154528516 TTGTATGTAAGGTGGATATTTGG + Intronic
1035751067 8:1996734-1996756 ATATATTTAATGTGGACATTAGG - Intronic
1036829647 8:12011952-12011974 ATGTGTTTATGGTGGGGATGTGG - Intergenic
1036899997 8:12663252-12663274 ATGTGTTTATGGTGGGGATGTGG - Intergenic
1037983443 8:23271896-23271918 AGGTCTTTAAAATGGTGATTAGG + Intronic
1038441334 8:27572787-27572809 GTGTCTTTAAAGAGGTGATTAGG - Intergenic
1038878080 8:31574289-31574311 AAATAATTAAGGTGGTGATATGG + Intergenic
1040291163 8:46125642-46125664 ATGTATTTAGGGTGGTGACAGGG + Intergenic
1041009115 8:53524152-53524174 ATGTATTTAAGGTGGTGACAAGG - Intergenic
1041030639 8:53732532-53732554 ATGTATTTCAGGTGGTGACAGGG + Intronic
1041886898 8:62820215-62820237 ATGTATCTCAGGTAGTGATATGG + Intronic
1042967417 8:74369898-74369920 ATGTCTTTAAAGTGCTGATGGGG + Intronic
1043015766 8:74939026-74939048 ATGTATTTAAAGTGCTGAAGGGG - Intergenic
1043198277 8:77329502-77329524 ATGTATTTATAGTGTTGGTTAGG + Intergenic
1043623627 8:82228186-82228208 ATGTATCTATGGTGTTGGTTGGG - Intergenic
1043998997 8:86855054-86855076 ATGTGTTTTGGATGGTGATTTGG + Intergenic
1045636974 8:104202737-104202759 TAGTATTTAAAGAGGTGATTAGG - Intronic
1048876873 8:138843481-138843503 ATGTATTTAAAGTGCTGAGCAGG + Intronic
1051699927 9:19811078-19811100 ATGTTATTGAGGTGGGGATTTGG + Intergenic
1053751199 9:41257775-41257797 ATGTATTTAATGAAGTGATCCGG - Intergenic
1054256721 9:62822104-62822126 ATGTATTTAATGAAGTGATCCGG - Intergenic
1054334586 9:63793508-63793530 ATGTATTTAATGAAGTGATCCGG + Intergenic
1055573905 9:77644102-77644124 ATGTCTTTAAAGAGGTGATTAGG + Intronic
1055697594 9:78903472-78903494 GAGTATTTAAGGTGGTTAATTGG + Intergenic
1056744971 9:89292867-89292889 ATGTATTTACAGTTGTGATAAGG - Intergenic
1056895051 9:90538189-90538211 AAATATTTAGGGTGGTGATATGG + Intergenic
1056988429 9:91387228-91387250 ATTTATTTAAGGTGAGGGTTGGG + Intergenic
1058231579 9:102433346-102433368 ATATATTTAAGATTGTGATTAGG - Intergenic
1060319366 9:122541641-122541663 CTGTATTTAAGGTGGAGGCTTGG - Intergenic
1061836326 9:133332432-133332454 ATGTCTGTAAGGTGGTGACGGGG - Intronic
1203663315 Un_KI270754v1:3255-3277 ATTTATTGAGGGAGGTGATTTGG + Intergenic
1186721192 X:12305996-12306018 ATGTAGCCAAGGTGGTGGTTAGG - Intronic
1187964669 X:24599590-24599612 GTGTATATAATGTGGTGCTTTGG + Intronic
1188532078 X:31152892-31152914 ATGTATTTTGGATCGTGATTTGG + Intronic
1191179687 X:57547138-57547160 ATGTAATTAATGTTTTGATTGGG - Intergenic
1191995305 X:67089081-67089103 ATGTATTGCATGTGGTGATGGGG - Intergenic
1192534487 X:71915659-71915681 ATGTATTTAATCTGCTGATTTGG + Intergenic
1192713306 X:73615050-73615072 ATGTTTTTATGGTGTTGGTTGGG + Intronic
1193043899 X:77032212-77032234 CTGTCTTTAAGATGGTGAATAGG - Intergenic
1193471711 X:81912152-81912174 ATGTTTTGAAGGTGATGATGGGG + Intergenic
1194734456 X:97495673-97495695 ATGTTTTTAAGGTGATGAGTGGG + Intronic
1198469760 X:136935264-136935286 ATGTATTTAAGGTGGTGACAGGG - Intergenic
1199535252 X:148895427-148895449 GTGTGTTTAAGGTGGTGGGTGGG - Intronic