ID: 1033110753

View in Genome Browser
Species Human (GRCh38)
Location 7:138572920-138572942
Sequence CTGTTGTTTTGTAGGAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 553
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 511}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033110753_1033110755 -6 Left 1033110753 7:138572920-138572942 CCTTTTCTCCTACAAAACAACAG 0: 1
1: 0
2: 2
3: 39
4: 511
Right 1033110755 7:138572937-138572959 CAACAGTAATGTATTCAGTGAGG No data
1033110753_1033110756 14 Left 1033110753 7:138572920-138572942 CCTTTTCTCCTACAAAACAACAG 0: 1
1: 0
2: 2
3: 39
4: 511
Right 1033110756 7:138572957-138572979 AGGTTAGTGCTGTAGATATATGG 0: 1
1: 0
2: 1
3: 9
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033110753 Original CRISPR CTGTTGTTTTGTAGGAGAAA AGG (reversed) Intronic
900254151 1:1688432-1688454 CTAATTTTTTGTAGTAGAAATGG - Intronic
900262868 1:1741374-1741396 CTAATTTTTTGTAGTAGAAATGG - Intronic
900775829 1:4584885-4584907 CTCTTGTTTTGAAGGAAAACAGG + Intergenic
902189534 1:14752410-14752432 ATTTTGTTTTGTAGCACAAATGG - Intronic
902921483 1:19668255-19668277 TTGTTGTTTTTTAAGAGACAGGG + Intronic
903551447 1:24159748-24159770 TTGTTTTTTTGTAGGGGATAGGG + Intronic
905789300 1:40782029-40782051 CTCTTGTTCTGTAGCAGAAATGG - Intergenic
905967855 1:42114383-42114405 CTGTTTTCTTGTATGAGAAAGGG + Intergenic
906940908 1:50254500-50254522 CTGTTGTGTTGCAGGTAAAAAGG + Intergenic
907065614 1:51479511-51479533 CTGTTCCTTTGGAGGAGAAGAGG + Intronic
907661460 1:56396593-56396615 CTGTTGGTGTGTAGGAGAGAAGG - Intergenic
907690748 1:56663100-56663122 TTGTTGTTTTTTAAGAGACAAGG + Intronic
908111974 1:60906914-60906936 CTGTTGTTTCCTAGGTGAGAAGG - Intronic
908166040 1:61459819-61459841 TTTTTGTTTTTTAGGGGAAAGGG + Intronic
908353929 1:63313390-63313412 GTTTTGTTTTGTATGAGACAAGG + Intergenic
908364460 1:63404331-63404353 CTGTTGCTTTATAAGAGAAATGG + Intronic
908523000 1:64962895-64962917 GTGTTGTTTTTTAGTAGAGATGG - Intronic
908550783 1:65206768-65206790 CTTTTGTTTTGTTTGAGACAGGG - Intronic
908613583 1:65891002-65891024 CAGTTGTTTCATAGGTGAAATGG + Intronic
908652950 1:66356037-66356059 ATGATGTTTTGTAGGGGATATGG + Intronic
908923768 1:69228339-69228361 CTGTTGATTTGTGGGAAAAAGGG - Intergenic
909140957 1:71864529-71864551 ATGTTGTATAGTAGGTGAAAAGG + Intronic
909456996 1:75861319-75861341 GTGTTCCTTTGGAGGAGAAAAGG + Intronic
909516417 1:76512245-76512267 GTGTGGGTTTGAAGGAGAAATGG - Intronic
910408041 1:86911271-86911293 TTGTTGTAGGGTAGGAGAAAGGG + Intronic
910584429 1:88863525-88863547 CTTTTTTTTTGTAGTAGAGATGG + Intronic
910661617 1:89679545-89679567 TTGTTGTTTTTTTGGAGACAGGG - Intronic
910827076 1:91420567-91420589 CTGTAGTTTTGTGAGGGAAAAGG - Intergenic
911421522 1:97647170-97647192 CTGTTGACTTTAAGGAGAAATGG + Intronic
911519164 1:98908224-98908246 CTGTAGTTCTTTAGGAGCAAAGG + Intronic
912443651 1:109716997-109717019 CTGTTCTTCTATATGAGAAACGG + Intronic
913181254 1:116324337-116324359 CTTTTGTATTTTAGTAGAAACGG - Intergenic
914895141 1:151663517-151663539 CCATTGTTTTGTTGCAGAAATGG + Intronic
914986059 1:152458041-152458063 TTGTTGTTTTGTAGGTAAAATGG + Intergenic
916009168 1:160689071-160689093 CATTTGTTTTAAAGGAGAAAGGG + Intronic
916249391 1:162722810-162722832 CAGTAATTTTGTAGCAGAAAGGG - Intronic
916564484 1:165961559-165961581 GTGTTGTAATGTAGAAGAAAGGG + Intergenic
916817911 1:168371406-168371428 ACCTTGTTTTGGAGGAGAAAAGG - Intergenic
917787357 1:178473061-178473083 TTGGTGTGTTGTAGGAAAAACGG + Exonic
918072986 1:181147339-181147361 CTGTTGTTGTTTTTGAGAAAGGG - Intergenic
920434143 1:205937350-205937372 ATGGTGTTTTGGAGGAGACATGG + Intronic
921356072 1:214285435-214285457 GAGTTGTTTTGGGGGAGAAATGG + Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
922249901 1:223839035-223839057 CTGTAGTTTTAAAGTAGAAAAGG - Intronic
922311755 1:224399965-224399987 TTGTTGTTTTTTAAGAGACAGGG - Intronic
922424174 1:225478438-225478460 CTGGTGTGTTGATGGAGAAAAGG + Intergenic
922992434 1:229925812-229925834 TTTTTCTTTTTTAGGAGAAAAGG + Intergenic
923392947 1:233531970-233531992 GTTTTGTTTTGTTTGAGAAACGG + Intergenic
923710064 1:236380716-236380738 CTGTTTGTTTGTTGTAGAAATGG + Intronic
924933553 1:248749167-248749189 CTATTGGTTTGTTAGAGAAATGG - Intronic
1063680607 10:8184047-8184069 CTGCTGTATTCTATGAGAAATGG - Intergenic
1064108061 10:12517929-12517951 CTTCTGTTTTCTAGAAGAAATGG + Intronic
1064390871 10:14941046-14941068 CTAATGTTTTGTAGCAGAGATGG + Intronic
1064823761 10:19371240-19371262 CTTTTGTTTTTTAAGAGACAGGG - Intronic
1064847231 10:19668762-19668784 CTCTTTTTTTGGAGGAGAAGGGG - Intronic
1065422465 10:25560956-25560978 GTGTTTTTTTTTAAGAGAAAAGG + Intronic
1065734896 10:28742882-28742904 TTGTTGTTTTTTTGGAGACATGG + Intergenic
1066149219 10:32597574-32597596 CTGTTTCTTTGGAGGAGAAGAGG + Intronic
1066594835 10:37038898-37038920 CTGTTGTGGGGTAGGGGAAAGGG - Intergenic
1067791418 10:49290917-49290939 CTGTTCTTTTTAATGAGAAATGG + Intergenic
1068420935 10:56792175-56792197 CTGTTGTTTTAGAGGGGAGATGG - Intergenic
1068813603 10:61284682-61284704 GTGTTATGTTGTAGTAGAAATGG + Intergenic
1069162525 10:65108947-65108969 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
1069220478 10:65877143-65877165 CTGTTGTTTTATAGCTCAAAAGG + Intergenic
1070008710 10:72451550-72451572 TTGTTGTTTTTTAAGAGACAGGG + Intronic
1070181005 10:74014236-74014258 CTGTTCTTTTTTTGGAGACAGGG + Intronic
1071380949 10:85058988-85059010 CTGTTGTTGAGTAGGGGAGAAGG + Intergenic
1072927214 10:99626524-99626546 CTTTTCTTTTGTAAGATAAAAGG - Intergenic
1072970400 10:100012236-100012258 TTGTATTTTTGTAGTAGAAACGG + Intergenic
1073613809 10:104972166-104972188 TTGTTGTTTTTTAGTAGAGATGG - Intronic
1074811304 10:117107830-117107852 GTTTTGTTTTGTTTGAGAAAGGG + Intronic
1075327513 10:121546210-121546232 CTGTTGTTTAAGAAGAGAAATGG + Intronic
1075569724 10:123531050-123531072 CTGTTGTTGTTTTGTAGAAACGG - Intergenic
1075843517 10:125525607-125525629 CTATTTTTTTTTAGTAGAAATGG + Intergenic
1078011877 11:7578696-7578718 CTGCTGTTTTGATGGAGAAGGGG + Intronic
1078174173 11:8956724-8956746 TTGTTGTTTTTTAAGAGACAAGG + Intronic
1078263792 11:9737468-9737490 TGGTTGTTTTGTTGGGGAAAGGG + Intronic
1078585955 11:12589114-12589136 CTGTTCTTTAGTAGAAGAAAAGG - Intergenic
1078697866 11:13652334-13652356 CTGTTCCTTTGAAGGAGAAGAGG - Intergenic
1078796708 11:14599796-14599818 GTGTTCCTTTGGAGGAGAAAAGG + Intronic
1078839531 11:15065486-15065508 CATTTGTTTTAAAGGAGAAAGGG + Intronic
1079024856 11:16938789-16938811 TTGTTGTTTTTTACAAGAAATGG - Intronic
1079404242 11:20131061-20131083 CTTTTATTTTTTAAGAGAAAGGG + Intergenic
1080138583 11:28888118-28888140 CTTTTGCTTTGTAGAAGAGAAGG + Intergenic
1080730544 11:34947492-34947514 GTCTTGTTTTGTAGGTGAAGCGG + Exonic
1081124733 11:39308893-39308915 CTGTTGTGGGGTAGGAGAAGGGG - Intergenic
1081589691 11:44412851-44412873 CTGGTCTTCAGTAGGAGAAAAGG + Intergenic
1081960209 11:47130461-47130483 CTGTTGTTTTATATTATAAATGG - Intronic
1082124380 11:48415124-48415146 GTGTTGTTTTGGAGGAGGAGAGG + Intergenic
1082299617 11:50490343-50490365 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
1085155947 11:74294496-74294518 CTGTTCCTTTGGAGGAGGAAAGG + Intronic
1085207884 11:74747930-74747952 CTGATGGTTTGTGGGAGATAAGG + Intergenic
1085567811 11:77530663-77530685 GTGATGTGTTGTAGAAGAAAGGG - Intronic
1085771418 11:79329431-79329453 CTTTTGTTTTGGTGGAGAGATGG + Intronic
1085835339 11:79950127-79950149 CTATAGTTTTCTAGGAAAAAGGG + Intergenic
1086847177 11:91765470-91765492 CTGTTACTGTATAGGAGAAAAGG - Intergenic
1087500593 11:98948137-98948159 CTGTTTTTTTGGAGGAGAAATGG - Intergenic
1087694631 11:101362442-101362464 CTGTTGGTTTGTAGGTGAGTAGG + Intergenic
1089039135 11:115429429-115429451 TTGTATTTTTGTAGTAGAAATGG - Intronic
1089441495 11:118521447-118521469 CTTTTGTTTTGCTGTAGAAAGGG + Intronic
1090196623 11:124822045-124822067 CAGTTGTTTTGTTGGGGAGAGGG + Intergenic
1090233101 11:125124257-125124279 CTTTTCTTTGGAAGGAGAAAGGG + Intergenic
1091060333 11:132455059-132455081 CTGTTATGTTTTAGGAGACAGGG - Intronic
1092091920 12:5810726-5810748 CTGGTGATTTGAAGGAGACATGG - Intronic
1093316661 12:17659792-17659814 CTGTTTTTTTATATGAAAAATGG - Intergenic
1093627054 12:21361476-21361498 CTGTTCCTTTGGAGGAGAAGAGG - Intronic
1094165504 12:27438773-27438795 TTGTTTTTTTGTGGGGGAAATGG - Intergenic
1094613886 12:32018810-32018832 TTATTGTATTGAAGGAGAAAAGG - Intergenic
1094865745 12:34528417-34528439 CGTTTGTTTTAAAGGAGAAAGGG - Intergenic
1096592791 12:52672935-52672957 AAGTTGTCTTGTAGGAGAAATGG - Intergenic
1097327531 12:58295527-58295549 CTGGAGTTTTGTAAGAGAATTGG + Intergenic
1097625067 12:61989925-61989947 GTGCTGTTTTGGAGGTGAAATGG - Intronic
1097728387 12:63100025-63100047 ATGTTGTTCTGTGGAAGAAATGG - Intergenic
1098376672 12:69822600-69822622 CTGTTGTTTGGTAGCACAATAGG + Exonic
1098589887 12:72198575-72198597 CTTTTGTTTTGTAGGAGCACTGG + Intronic
1099247128 12:80206004-80206026 CAGTGCTTTTGTAGCAGAAAGGG + Intergenic
1099555334 12:84102786-84102808 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
1099769621 12:87034371-87034393 CTGTTGTATTGGAGGTGTAAGGG - Intergenic
1100250501 12:92817377-92817399 CTGTTTTTTTTTAAGAGACAGGG + Intronic
1100462120 12:94809909-94809931 TTGTTTTTTTGTAGTAGAAAGGG - Intergenic
1100936806 12:99679313-99679335 TTGTTGTTTTGTTTGAGACAGGG + Intronic
1101208460 12:102512758-102512780 CTTCTGTTTAGAAGGAGAAAGGG - Intergenic
1101689049 12:107057886-107057908 TTGTTGTTTTTTTGGAGAGACGG - Intronic
1103575464 12:121873974-121873996 CTGTTGTTTTGTTTGAGACAGGG - Intergenic
1103770257 12:123317008-123317030 CTTTTCTTTTGGTGGAGAAAGGG + Intronic
1104225399 12:126827800-126827822 GTGATGTGTTGTAGGAAAAAAGG + Intergenic
1105018322 12:132799634-132799656 CTGCTGTTTTTTCGGAGACAGGG - Intronic
1106001781 13:25730368-25730390 CTTTTGTTTTGAAGAACAAAAGG + Intronic
1106510753 13:30410435-30410457 TTGTTGTGTTTTAGTAGAAATGG - Intergenic
1107223210 13:38012094-38012116 CTGCTGATTTGAAAGAGAAAAGG + Intergenic
1107967849 13:45613663-45613685 CTGATGCTTTCTAGAAGAAAGGG - Intronic
1108650393 13:52472625-52472647 CTTTTCTTTTTTGGGAGAAAGGG - Intronic
1108886672 13:55193618-55193640 CTTCTGATTTGTAGGATAAAAGG + Intergenic
1109572915 13:64216072-64216094 GTGTTCCTTTGGAGGAGAAAAGG + Intergenic
1111476540 13:88756780-88756802 CTTTTATTTTGTAAGAGGAAAGG - Intergenic
1112386016 13:98940403-98940425 TTGTTGTTTTTTAAGAGATAGGG + Intronic
1112617751 13:101022442-101022464 CTGGTGTGTAGTAGGAGAAGAGG - Intergenic
1112759066 13:102672620-102672642 CTGATTTTGTGAAGGAGAAAGGG - Intronic
1112956439 13:105064644-105064666 CTCTTGTTTTGGGGAAGAAACGG + Intergenic
1112956568 13:105066326-105066348 CCCTTGTTTTGGAGAAGAAAAGG - Intergenic
1113331393 13:109331387-109331409 TTGTTGATTTGTAAGATAAAAGG - Intergenic
1113383729 13:109828431-109828453 GTGTTCCTTTGTAGGAGAATGGG + Intergenic
1113403521 13:110017692-110017714 CAGTTTTTCTGTAGGAAAAAAGG - Intergenic
1114308393 14:21443680-21443702 CTGTTATTTTTTAGTAGAGATGG - Intronic
1114837639 14:26222428-26222450 GTGTTGTTTTCAAGTAGAAATGG - Intergenic
1115225428 14:31096997-31097019 CTTTTGTTTTGTAAGAGATGGGG + Intergenic
1115297587 14:31846605-31846627 ATGTTCTTTTGTAGAAGAAGTGG + Intronic
1115504685 14:34081840-34081862 CTGGTGTTTGGTGGCAGAAATGG + Intronic
1115665256 14:35537873-35537895 TTTTTGTTTTTTAGTAGAAACGG - Intergenic
1116592122 14:46790781-46790803 CTGATATTTTGAATGAGAAAGGG + Intergenic
1116662174 14:47724252-47724274 GTTTTGTTTTGTTTGAGAAAGGG - Intergenic
1116716482 14:48432451-48432473 TTGTTGTTTTTTAAGAGACAGGG + Intergenic
1117257730 14:53997027-53997049 CAGTTGTCTTGTAGTAAAAATGG - Intergenic
1117284470 14:54273479-54273501 CTGCTGTCTGGCAGGAGAAATGG - Intergenic
1118162919 14:63309129-63309151 TTGTTGGTTTGTAAAAGAAATGG + Intergenic
1118487284 14:66225667-66225689 CTTTTTTTAAGTAGGAGAAAAGG - Intergenic
1119214221 14:72856284-72856306 CTCCTGTTTTAGAGGAGAAAAGG - Intronic
1119363342 14:74070167-74070189 CTGTTATTTTGGAGGAAAATAGG - Intronic
1119368396 14:74115902-74115924 CTGATTTTTTGTAGGGGAAGGGG + Intronic
1120859437 14:89241642-89241664 CTGTTGCCTAGTGGGAGAAAAGG - Intronic
1121031086 14:90659293-90659315 GTGTTTTTTTTTAGGAGAAAGGG + Intronic
1121326460 14:93022824-93022846 TTGTTGTTTTTTAAGAGATATGG - Intronic
1123712417 15:22998463-22998485 CTTTTTTTTTGTTGGAGACAAGG + Intronic
1124859140 15:33421137-33421159 CTGGTGAATTGGAGGAGAAACGG + Intronic
1124899268 15:33807429-33807451 CTGTTGTGTTGGCTGAGAAATGG + Intronic
1124943327 15:34238935-34238957 CTTTAGGTTTGTATGAGAAATGG + Intronic
1125017652 15:34952357-34952379 CTGGTGTTCTGTTTGAGAAATGG + Intronic
1125236200 15:37516600-37516622 CTAATGGTTTGTAGGAGAAATGG - Intergenic
1125491387 15:40151155-40151177 GTTTTGTTTTGTTGGAGACAGGG - Intergenic
1125567670 15:40689490-40689512 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
1126056690 15:44736415-44736437 CTTTTCTTTTGTAGGAGACAAGG - Exonic
1126401696 15:48277817-48277839 CTGGTATGTTGTAGGAGAAGAGG + Intronic
1126899082 15:53293265-53293287 TTGTTTTTTTTTAGTAGAAAGGG - Intergenic
1127098040 15:55533495-55533517 CTTTTGATTTGTAGGAGAGAAGG + Intergenic
1127582830 15:60353337-60353359 CTGTTGTGGTGGGGGAGAAAGGG - Intronic
1128394189 15:67207009-67207031 GTGTTGTTTTTTAGTAGAGACGG - Intronic
1128671331 15:69576616-69576638 CTCTTGTTTTTTTGGGGAAAGGG + Intergenic
1128776610 15:70325121-70325143 CTTTTGTTTTGTTGAATAAAAGG - Intergenic
1128835881 15:70808719-70808741 TTTTTTTTTTTTAGGAGAAATGG + Intergenic
1128838258 15:70828843-70828865 CTTTTGTTTTGTTTGAGACAGGG + Intergenic
1129952618 15:79605505-79605527 ATGTTGTTTGGAAGGGGAAATGG - Intergenic
1129977896 15:79837862-79837884 CTGTTGTTTCCTAGGTGACAGGG + Intronic
1130007900 15:80119130-80119152 CAGTTGCTTTATGGGAGAAATGG + Intronic
1130461565 15:84162636-84162658 ATGTTGTTTTGTAGAAGTAGTGG - Intergenic
1131678750 15:94699744-94699766 CTGTTGTTTTTGGGGAGTAAAGG + Intergenic
1132531910 16:455601-455623 TTGTTGTTTTTTGGGAGATAGGG + Intronic
1133176239 16:4016993-4017015 CTGTTTTTTTGAAAAAGAAAAGG + Intronic
1133238676 16:4402260-4402282 TTGTTGTTTTTTAAGAGAGAGGG + Intronic
1133476592 16:6127848-6127870 CTTTACTTTTGTTGGAGAAAAGG + Intronic
1133480372 16:6164647-6164669 TTGTTTTTTTTTAGTAGAAATGG + Intronic
1133654240 16:7844356-7844378 ATGTTATTTTGTGGAAGAAATGG - Intergenic
1133757158 16:8770443-8770465 CTTTTGTTTTGTTTGAGACAGGG + Intronic
1135380828 16:21994994-21995016 CTTTCGTTTTGTTGTAGAAATGG + Intronic
1135478671 16:22802080-22802102 CTGTTGTTTTGAAAAAGAAGTGG - Intergenic
1135630267 16:24031055-24031077 CTTTTGTTTTTTAAGAGACATGG - Intronic
1135821355 16:25689512-25689534 CTATTGTTTTCTAGGATGAAGGG + Intergenic
1136104793 16:28022330-28022352 TTTTTGTTTTTTAGGAGACAAGG + Intronic
1138290321 16:55841165-55841187 CTGTTTTTTTTTAGGATAATTGG - Intergenic
1138767763 16:59624461-59624483 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
1139281807 16:65777244-65777266 TTGTTGATTTGTTGGAGCAAGGG - Intergenic
1140040148 16:71402176-71402198 CTGTTGTTCTGTGGGAGGGAGGG - Intergenic
1140603432 16:76505891-76505913 ATTTTGTTTTGTAAGAGACAAGG - Intronic
1140710021 16:77668992-77669014 TTGTTGTTCAGAAGGAGAAAGGG - Intergenic
1142929831 17:3274285-3274307 CTGTTTGTCTGTAGAAGAAATGG - Intergenic
1143583674 17:7840625-7840647 CCATTCCTTTGTAGGAGAAAAGG + Intronic
1144561905 17:16327629-16327651 TTGTTGTTTTTTTGGAGACAGGG - Intronic
1144791791 17:17863870-17863892 TTGTTGTTTTGTTTGAGACAGGG + Intronic
1145801486 17:27688758-27688780 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
1146526492 17:33571355-33571377 CTGTTGTTTTGGTGGAAAACAGG - Intronic
1149050643 17:52300533-52300555 CAGTTATTTTGTAGGTAAAATGG + Intergenic
1149808086 17:59638327-59638349 CTGTTTTTTTTTAAGAGACAGGG - Intronic
1150133859 17:62683856-62683878 CTTTTTTTTTTTTGGAGAAAGGG - Intronic
1150254302 17:63731869-63731891 CTTTTGTTTTTTATGAGACAGGG + Intronic
1150783916 17:68147182-68147204 CTTTTGTTTTTTAAGAGACAGGG - Intergenic
1150850456 17:68699164-68699186 CTGTTCCTTTGTAGGGGAGAAGG + Intergenic
1150879680 17:69009734-69009756 CTGGTGTTTTGTAGGAGAGATGG + Intronic
1151018725 17:70587586-70587608 CTGTTTTTTTTTAAAAGAAATGG + Intergenic
1151409760 17:73914472-73914494 CTTTTGCTTTGTAGGAGAGAAGG - Intergenic
1151412645 17:73941476-73941498 CTGTAATTTTCTAGGAAAAAGGG - Intergenic
1153895098 18:9551620-9551642 CTTTTGCTTTGCACGAGAAAAGG - Intronic
1154165170 18:12009266-12009288 TTGTTGTTTTTTAAGAGATAGGG - Intronic
1156047600 18:32894776-32894798 TCGTTGTTTTATAGGGGAAATGG + Intergenic
1156195155 18:34766517-34766539 CTGTTGTGGTGTGGGAGGAAGGG + Intronic
1157902186 18:51529157-51529179 CTGATTTTTTATATGAGAAAGGG - Intergenic
1158034033 18:53003016-53003038 ATTTTGTTTTGTAGGAGCCAAGG + Intronic
1158462498 18:57658670-57658692 CTTTTTTGTTGTTGGAGAAAGGG + Intronic
1161253004 19:3291257-3291279 TTGTTTTTTTGTATGAGACAGGG - Intronic
1162714739 19:12623066-12623088 TTGTTGTTTTCTAAGAGACAGGG - Intronic
1163396575 19:17066686-17066708 CTGTTGTTGAGTGGGAGAATAGG + Intronic
1163576843 19:18115828-18115850 CAATTGTATTGTAGGAGCAATGG - Intronic
1164197124 19:22978944-22978966 GTGATCCTTTGTAGGAGAAAAGG - Intronic
1164877464 19:31701435-31701457 CTGTGTTTGTGTATGAGAAAGGG - Intergenic
1165318180 19:35069475-35069497 CTGTTGCTTTGTTGGAGGAGTGG + Intergenic
1165664105 19:37611195-37611217 ATTTTTTTTTTTAGGAGAAATGG + Intronic
1166345699 19:42163958-42163980 CTGTTGTTAGGAAGAAGAAAAGG + Intronic
1166522497 19:43490187-43490209 CTGTGGTTGTGTAAGAGAATGGG + Intronic
1166640919 19:44494664-44494686 TTGTTGTTTTTTAAGAGACAGGG - Intronic
1166834859 19:45661139-45661161 CTTTTGTATTTTAGTAGAAATGG + Intergenic
1167028675 19:46941560-46941582 CTTTTGTTTTTTAAGAGACAGGG - Intronic
1167153257 19:47722382-47722404 CCGTTGTTTTGGGGGAGGAAGGG - Intronic
1167484730 19:49755520-49755542 TTGTTGTTTTTTATGAGACAGGG - Intronic
1167554030 19:50181743-50181765 TTGTAGTTTTGTAGTAGAGATGG + Intergenic
1167966798 19:53154309-53154331 CTTTTTTTTTTTAAGAGAAATGG - Intronic
1168701832 19:58444730-58444752 AAGTTTTTTGGTAGGAGAAAAGG - Intergenic
925038177 2:708480-708502 CTGTTATCTTGTAGGAACAATGG + Intergenic
925531333 2:4866000-4866022 CTTTTGTTTTATTGTAGAAATGG + Intergenic
926506807 2:13726267-13726289 CTGATGTATTTTAGGGGAAAAGG - Intergenic
926703045 2:15816940-15816962 CTGTTGCTGTGATGGAGAAAAGG - Intergenic
926806247 2:16714602-16714624 TTGTTGTTATATAGGAGGAAGGG + Intergenic
927313562 2:21656524-21656546 CTGCTGTTTTGTACTAGAGAAGG + Intergenic
928432064 2:31228285-31228307 CTGGTGTTGTGGATGAGAAAGGG + Intronic
928503860 2:31928098-31928120 GTGTTGTTTTCCAAGAGAAATGG - Intronic
929145574 2:38704494-38704516 CTATTTTTTTGTAGTAAAAATGG - Intronic
929279482 2:40062228-40062250 CTGTTTTTTAGTAGGAGACATGG + Intergenic
930809820 2:55528790-55528812 CTACTGTTTTGCAGTAGAAATGG + Intronic
931350933 2:61488263-61488285 ATTCTGTTTTGTAGGTGAAATGG - Exonic
931486838 2:62702463-62702485 CTGTTGGTTGGTAGGGGAAATGG + Intronic
931509051 2:62968927-62968949 CTGCTCTTTTGTAGGCAAAAAGG - Intronic
931862908 2:66375650-66375672 GTCTTGTTTTGTAGGGGCAATGG + Intergenic
932166897 2:69516405-69516427 GTTTTGTTTTGTTGGAGAATAGG - Intronic
932600625 2:73122470-73122492 CTTTTGTTTTGGTAGAGAAAAGG - Intronic
932778731 2:74546358-74546380 CTTTTGTTCTGTGGGAGATAAGG - Intronic
933365885 2:81353198-81353220 CTGTTGTTTTATATAAAAAAAGG - Intergenic
933430780 2:82175450-82175472 TTGTTGTTTTTTAGTAGAGACGG + Intergenic
933676281 2:85060620-85060642 TTTTTGTTTTTTAGGAGAGACGG + Intergenic
933932650 2:87169642-87169664 CTTTTTTCTTTTAGGAGAAAAGG + Intergenic
934863002 2:97780011-97780033 TTTTTGTTTTTTTGGAGAAAAGG - Intronic
935142337 2:100364396-100364418 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
935316173 2:101836412-101836434 GTGTTGTTTTATAGTAGAGACGG - Intronic
935466594 2:103405648-103405670 TTGTTGTTTTTTAAGAGACAGGG - Intergenic
935685981 2:105683183-105683205 TTGTTGCTTTGTAAGTGAAAGGG - Intergenic
935972461 2:108543571-108543593 CTGTGATTTAGTAGGAGACAAGG + Intronic
936360460 2:111795800-111795822 CTTTTTTCTTTTAGGAGAAAAGG - Intronic
936717742 2:115208693-115208715 CTGTTATGGTGTTGGAGAAATGG + Intronic
937602283 2:123753142-123753164 GTTTTGTTTTTTAGAAGAAAAGG + Intergenic
938586141 2:132692321-132692343 TTGTTGTTTTTTAGTAGAGATGG + Intronic
938889659 2:135691588-135691610 CTGTTTTTTTTTTGGAGACAGGG - Intronic
938908060 2:135858183-135858205 TTGTTGTTTTTTAAGAGACAGGG - Intronic
939473989 2:142662149-142662171 ATTTTGTTAAGTAGGAGAAAGGG - Intergenic
939867994 2:147496053-147496075 ATGTTGTTTTTTAGGGAAAATGG + Intergenic
940508583 2:154585446-154585468 TTGTTGTTTTGTAGAAGGATTGG + Intergenic
940666310 2:156614212-156614234 CTCTTGTTTGGTATCAGAAAGGG - Intergenic
940818068 2:158318774-158318796 CTGTTTTTTTTTTGGAGACAGGG + Intronic
940905816 2:159168470-159168492 TTTTTGTTTTTTAGTAGAAATGG + Intronic
941584585 2:167341690-167341712 TTGTTCATTTGTAAGAGAAAAGG - Intergenic
942107700 2:172649420-172649442 ATGTTCTTTTGGAGGAGAAGAGG - Intergenic
942519948 2:176793123-176793145 CCTTTGTTTTGTAGATGAAATGG - Intergenic
942798191 2:179845945-179845967 CTGTTCTTTTGAAAGATAAAGGG + Intronic
943556900 2:189416555-189416577 CTGTTGTGGGGTAGGAGGAAGGG + Intergenic
943678654 2:190744193-190744215 CTGTTGGTGTGTGGGAGCAAAGG - Intergenic
944629940 2:201613642-201613664 GTGTTCCTTTGTAGGAGAAACGG - Intronic
944717036 2:202384929-202384951 CTACTGTCTTGAAGGAGAAAGGG - Intronic
945839123 2:214867460-214867482 CGCTTGTTTGTTAGGAGAAAAGG - Intergenic
945958174 2:216105620-216105642 CTTTTGTTGTGGAGGAGGAAGGG + Intergenic
946251788 2:218418516-218418538 CTCTTGGTTGGTAGGAGGAAAGG + Intergenic
946911222 2:224463396-224463418 ATGTTATTTTGTATGACAAATGG + Intergenic
946916199 2:224524778-224524800 GTTTTGTTTTGTGGGGGAAACGG - Intronic
947170251 2:227303845-227303867 TTGTTTGTTTTTAGGAGAAAAGG + Exonic
947294064 2:228611711-228611733 CTGTTGTTTTCTTGGAGCAATGG - Intergenic
947983502 2:234429269-234429291 CTGCTGACTTGGAGGAGAAAGGG - Intergenic
1168794423 20:602043-602065 TTGTTGTTTTGTTTGAGATAGGG - Intergenic
1168882376 20:1217809-1217831 GTGTTCTTTTGGAGGAGAAGAGG - Intergenic
1169611019 20:7380216-7380238 ACGTTGTTTGGAAGGAGAAATGG - Intergenic
1169910358 20:10643230-10643252 TTTTTGTTCTGTAAGAGAAAGGG + Intronic
1169968947 20:11248028-11248050 CTCTTGTTTGGTGGGAGAAATGG + Intergenic
1171569204 20:26231866-26231888 CTTTTGTGATGTAGGAGAAAGGG - Intergenic
1172343344 20:34177021-34177043 CTGTTGTGTGGTAGGTGAATGGG - Intergenic
1173742757 20:45413004-45413026 CTGTGGTTCGGCAGGAGAAAAGG - Intergenic
1174910151 20:54599268-54599290 CTCTTCTTTTGTAAGAAAAAGGG + Intronic
1175973968 20:62701154-62701176 CTGATGTTTTGGAGGAAACAGGG - Intergenic
1177581126 21:23022545-23022567 CTGCTACTTTGTAGGAGAGATGG + Intergenic
1177627284 21:23679107-23679129 CAGTGGTTTTGTATGAGACATGG - Intergenic
1178329706 21:31677247-31677269 CGGTTGTTATGTAGGTGAGAGGG - Intronic
1179229077 21:39484590-39484612 CTCTTGTTTTGTGGAAGAAAGGG + Intronic
1179230719 21:39501594-39501616 CTGTCTTTCTGTAGGATAAATGG - Intronic
1180181345 21:46119924-46119946 CTGTTGTTCTCTGGGAGGAATGG - Intronic
1183410630 22:37653256-37653278 TTGTTTTTTTGTAGTAGAGACGG - Intronic
1183827884 22:40402844-40402866 CTGTTGTTTTCTACTATAAATGG + Intronic
1185061532 22:48609592-48609614 TGGTTCTTTTGCAGGAGAAACGG - Intronic
1203238936 22_KI270732v1_random:34449-34471 CTTTCGTGATGTAGGAGAAAGGG + Intergenic
949557878 3:5173562-5173584 CTGATTTTTTGTAGTAGAGACGG - Intronic
949700691 3:6753757-6753779 CTGATCTTTTGTAACAGAAAAGG - Intergenic
949816793 3:8067675-8067697 GTGTTCTTTTGGAGGAGAAGAGG + Intergenic
949897033 3:8775588-8775610 CTGTTCTTTTGCAGAAGAAAGGG + Intronic
950209134 3:11105375-11105397 GTTTTGTTTTGTAAGAGACAGGG + Intergenic
950273550 3:11639403-11639425 CTGTTGTGATGTTGGGGAAAGGG - Intronic
951093833 3:18605357-18605379 TTGTATTTTTGTAGGAGAGAAGG + Intergenic
951678125 3:25265421-25265443 TTGTTTTTTTGTAGTAGCAAGGG - Intronic
952872829 3:37917064-37917086 CTGTTGCTTTATAGGTGAAAAGG + Intronic
953146551 3:40281371-40281393 CTGCTGTTTTGGAGGAACAAAGG - Intergenic
953340317 3:42128849-42128871 CTGTTTTGTTATAGGTGAAATGG + Intronic
954187794 3:48932325-48932347 GTGTTGTGTTGTAGGAGGAGGGG + Intronic
954548908 3:51463770-51463792 TTGTTGTTTTTTTGGAGACAGGG - Intronic
954727250 3:52623290-52623312 CTGTTATTTTTTAGGAAACAGGG - Intronic
955166454 3:56519043-56519065 CTGCTGATTGGTAAGAGAAATGG - Intergenic
955818501 3:62873577-62873599 CTGTTCTTTAGCTGGAGAAAGGG - Intronic
956642109 3:71425120-71425142 GTTTTGTTTTGTATGAGACAGGG + Intronic
956808593 3:72842204-72842226 CTGTGTATTTGTAGGGGAAATGG - Intronic
957180148 3:76867150-76867172 CTGTTATTTTGTAAGACAAGAGG + Intronic
958183868 3:90093894-90093916 CTGTATTGTTGGAGGAGAAAAGG - Intergenic
959620663 3:108395639-108395661 TTTTTTTTTTTTAGGAGAAAGGG + Intronic
959725537 3:109537826-109537848 CTATAATTTAGTAGGAGAAAAGG - Intergenic
960530034 3:118753747-118753769 TTGTTGTTTTTTTGGAGACAAGG - Intergenic
960812195 3:121635944-121635966 ATGTTGTTTTGTGGTAGAGAGGG + Intronic
960866283 3:122202913-122202935 CTGTGTATTGGTAGGAGAAAGGG - Intronic
961922838 3:130446006-130446028 CATTTGTTTTAAAGGAGAAATGG + Intronic
962304900 3:134277527-134277549 CTCTTTTTATGTAGGTGAAAGGG - Intergenic
962460712 3:135609988-135610010 CTGTTGTTGGGTGGGAGAAGGGG + Intergenic
962690956 3:137897684-137897706 CTGTTGCTTTGAAGGAGGAGAGG - Intergenic
963361741 3:144282527-144282549 CTTTTGTTCCCTAGGAGAAAAGG - Intergenic
963704202 3:148665509-148665531 CTGCTGTTTTCCAAGAGAAATGG - Intergenic
963903084 3:150751259-150751281 CTTTTGTATTGTAGTAGAGATGG - Intronic
964348183 3:155776301-155776323 TTTTTATCTTGTAGGAGAAAAGG + Intronic
964610799 3:158613003-158613025 ATTTTGTTTTTTAGGAGAGATGG + Intergenic
964947829 3:162247719-162247741 GTGTTGCTTTGGAGGAGAAGAGG - Intergenic
966818686 3:183908670-183908692 TTTTTTTTTTGTAGTAGAAATGG - Intergenic
966924010 3:184632944-184632966 CTGTTGATATGTGGAAGAAAAGG - Intronic
968403140 4:316109-316131 CTGTTGTTTTCTGGGTGAATGGG + Intergenic
968528732 4:1078671-1078693 CTGTTGGTGTCAAGGAGAAAGGG - Intronic
969008895 4:4044635-4044657 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
969044174 4:4324508-4324530 CTCTTATTTTGTAAGAGAGAGGG + Intergenic
969778506 4:9378046-9378068 CTGGTGTCTTGTAGAAGAATGGG + Intergenic
969942638 4:10749751-10749773 CTCTGGATTTCTAGGAGAAAAGG - Intergenic
970158363 4:13164296-13164318 CTTTTATTTTGAAGAAGAAAGGG - Intergenic
970231405 4:13915061-13915083 GTGTACTTTTGTTGGAGAAAAGG - Intergenic
970482447 4:16490169-16490191 CTGTTGTCTAGTAGAAGAATAGG + Intergenic
971778588 4:31000690-31000712 CACATGTTTTGTAGGAGAGAAGG - Intronic
972441067 4:39092160-39092182 CTCTTCTTTTGTAGCAGAGAAGG + Intronic
972685712 4:41350529-41350551 GTGATCTTTTGGAGGAGAAAAGG - Intergenic
972981592 4:44710507-44710529 CTGTTGGTTTCCAGCAGAAAAGG - Intronic
973098107 4:46227201-46227223 ACTTTGTTTGGTAGGAGAAATGG + Intergenic
973217323 4:47683956-47683978 CTATTGTTTTATAGGTGAGAAGG + Intronic
974483532 4:62476217-62476239 CTTTTGTTTTGTTTCAGAAAGGG + Intergenic
975795101 4:77998593-77998615 TTGTTGTTTTTTAGTAGAAAGGG + Intergenic
975955049 4:79826904-79826926 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
976363177 4:84203701-84203723 GTGATGTTTTGGAGGAGAAGAGG - Intergenic
977035026 4:91939745-91939767 CTGTTGTTTTATATAAAAAAAGG - Intergenic
977633495 4:99269661-99269683 CTGTTCCTTTGGAGGAGAAGAGG + Intergenic
978510183 4:109508390-109508412 TTGTTTTTTTGGAGGAGAAGGGG - Intronic
978868071 4:113539720-113539742 CTGCAGTTATGTAGAAGAAAAGG + Intronic
978986162 4:115015428-115015450 ATTTTGTTTGGAAGGAGAAATGG + Intronic
979047020 4:115880090-115880112 TTGTTGTTTTGTTTTAGAAAGGG - Intergenic
979087836 4:116436331-116436353 CTTTTGTTCTGAAGGAGAAATGG + Intergenic
980296124 4:130920160-130920182 CTGTTGTTTTGAAGTAAAAATGG - Intergenic
980429456 4:132673292-132673314 CTGTGGTACTGTAGAAGAAAGGG + Intergenic
980481498 4:133394292-133394314 TTTTTTTTTTTTAGGAGAAAAGG + Intergenic
980978751 4:139635909-139635931 CATTTGTTTTAAAGGAGAAAGGG - Intergenic
981374612 4:143999441-143999463 ATTTTGCTTTATAGGAGAAACGG - Exonic
981384936 4:144118744-144118766 ATTTTGCTTTATAGGAGAAAGGG - Exonic
981743782 4:148031839-148031861 CTGTTTTTTTATGAGAGAAAGGG + Intronic
982371318 4:154636885-154636907 CTGTTGTGGGGTAGGGGAAAAGG + Intronic
982949516 4:161672469-161672491 TTGTTTTTTTGTAGGAAGAATGG + Intronic
982996050 4:162347248-162347270 ATATTGATTTCTAGGAGAAAAGG + Intergenic
983332878 4:166353901-166353923 CTGGTGTTTAGTAGAAGAAGGGG + Intergenic
984171157 4:176360918-176360940 CTGCTGTACTTTAGGAGAAAGGG - Intergenic
984204798 4:176773687-176773709 TTGTTGTTTTTTAAGAGACAGGG + Intronic
984472960 4:180200639-180200661 TTGGGGTTTTGTTGGAGAAAGGG + Intergenic
984979840 4:185269746-185269768 TTGTTGTTTTTTAAGAGACAAGG + Intronic
985096326 4:186416334-186416356 CTCCTGTTTTTGAGGAGAAAAGG + Intergenic
985141816 4:186847806-186847828 CTGTTATTTTTTAAGAGTAAAGG - Intergenic
986929397 5:12798719-12798741 CTTTTGTTTTGTTGTTGAAACGG + Intergenic
987102387 5:14603615-14603637 CTGTTATCTTCTTGGAGAAATGG + Intronic
987772784 5:22328626-22328648 CTGTTGTTTTATGGCACAAATGG - Intronic
988211478 5:28210178-28210200 CTGTTGTTATGAAGGACAACGGG - Intergenic
988632433 5:32945406-32945428 CTGTTTTTTTCTGGGGGAAAGGG + Intergenic
989318674 5:40110238-40110260 CATTTGTTTTAAAGGAGAAAGGG - Intergenic
990708673 5:58558845-58558867 TTTTGGTTTTGTAAGAGAAAAGG + Intergenic
990745729 5:58958140-58958162 CTGTTCCTTTGGAGGAGAAGAGG + Intergenic
992596930 5:78356647-78356669 CGGTTGGTTTGCAGGAGAGAGGG + Intergenic
992855154 5:80852560-80852582 CTGTTTTGTGGTAGGGGAAAAGG + Intronic
993838190 5:92841542-92841564 CTATTGTTTTGGAAGATAAAGGG - Intergenic
994642841 5:102431705-102431727 CTGTTGTTTTTTTGGTGAAGAGG + Intronic
996217336 5:120886237-120886259 ATGTTATTTTGTAGGTGAATGGG - Intergenic
997289535 5:132718314-132718336 TTGTTGTTTTGTTTGAGACAGGG + Intronic
997923461 5:138005065-138005087 CTTTTGTATTTTAGGAGAGATGG - Intronic
998658001 5:144204348-144204370 CTGGTGTTTTAAAGGGGAAATGG + Intronic
998788871 5:145744236-145744258 CTGCTGGTCTGCAGGAGAAAAGG - Intronic
999977229 5:156923842-156923864 CTGTTATTTTGTTTGAGACAGGG + Intronic
1001169525 5:169405565-169405587 CTTTGGTGTTCTAGGAGAAATGG - Intergenic
1001849163 5:174948543-174948565 ATGTAGATTTGTGGGAGAAATGG - Intergenic
1004491967 6:16126171-16126193 TTTTTGTTTTGTTTGAGAAAGGG + Intergenic
1004802951 6:19171233-19171255 CTGCTCCTTTGCAGGAGAAAAGG + Intergenic
1004853469 6:19724940-19724962 TTGTTTTTTTGTTGGAGAGATGG + Intergenic
1005569121 6:27127459-27127481 CTTTTTTTTTGGAGGGGAAAGGG + Intronic
1006679978 6:35789931-35789953 GTTTTGTTTTGTTGGAGACAGGG + Intronic
1009321670 6:62298151-62298173 TGATTGTTTTGAAGGAGAAAGGG + Intergenic
1009444019 6:63718126-63718148 ATTTTGATTTATAGGAGAAAAGG + Intronic
1010201915 6:73289641-73289663 CTGTTGTTTGTTATGAGACAGGG - Intronic
1010898480 6:81396126-81396148 CTGTTGTTTTGGAGGGAATAAGG - Intergenic
1011096336 6:83668674-83668696 CTGTTGTGGTGTAGGGGAAGGGG + Intronic
1011358431 6:86497157-86497179 CTGTTCCTTTGTAGGAGGAGAGG + Intergenic
1012160585 6:95880378-95880400 CTTTTGTTTGGTAGGAGAGATGG - Intergenic
1012617122 6:101290948-101290970 CTGTTTATTTTTAGGGGAAATGG + Intergenic
1012748592 6:103127030-103127052 CGGTAGTTTTGTAGGTGAAATGG - Intergenic
1013193577 6:107825548-107825570 TTGTTGTTTTGTATGGGAAAAGG + Intergenic
1013248860 6:108314567-108314589 CTTTTGTGTTTTAGTAGAAACGG + Intronic
1013370388 6:109465469-109465491 TTTTTGTTTTCTAGGACAAAGGG - Exonic
1013393627 6:109712779-109712801 CAGTTGTTTTGGAGGAAAAAAGG + Intronic
1013535592 6:111060504-111060526 TTGTTGTTTTTTAGGAAACAGGG - Intergenic
1014013400 6:116501959-116501981 GTGTTCTTTTGGAGGAGAAGAGG - Intronic
1014461727 6:121704003-121704025 GTGATCTTTTGGAGGAGAAAAGG - Intergenic
1015020013 6:128461999-128462021 CTTTTGTTTTTTAAGAGACAGGG + Intronic
1015754331 6:136592489-136592511 CTCTTGTTTTGAAAGAGAAGGGG + Exonic
1017130805 6:151106901-151106923 CAGTTGGTTTCTAGGACAAAAGG + Intergenic
1018056795 6:160059113-160059135 ATGTTGTTTTGTAGCTAAAAAGG + Intronic
1018874557 6:167809222-167809244 CTTTTGTTTTGTGGGAGGATGGG - Intergenic
1019069262 6:169328620-169328642 CTCTTGTTTTCCAGGAGAAGGGG - Intergenic
1020198075 7:6058088-6058110 CTTTTGTTTACTAGGAGATACGG - Intronic
1020617276 7:10475634-10475656 CTGTCGTTTTTCAGAAGAAATGG - Intergenic
1021061217 7:16115248-16115270 CTATTGTTTTCTAAGAGATATGG + Intronic
1021085415 7:16416833-16416855 CTATTGTTTTTTTGGAGATAGGG - Intronic
1021154042 7:17187226-17187248 ATGTTTTCTGGTAGGAGAAAAGG + Intergenic
1021156052 7:17211346-17211368 CTATTATTTTGTAGCAAAAATGG - Intergenic
1021405595 7:20263611-20263633 TTGTTGTTTTTTAGTAGAGATGG + Intergenic
1022024248 7:26430945-26430967 CTGATGTTTTATAGCAGCAAAGG + Intergenic
1022173511 7:27851676-27851698 TTTTTGTTTTTTAGGAGACAAGG - Intronic
1024393802 7:48843832-48843854 CTGGTGTTTTGTCTGAGAAAAGG - Intergenic
1024401446 7:48928583-48928605 CTGGTGTTTTGTCCGAGAAAGGG + Intergenic
1024464770 7:49700624-49700646 CTGTTGCTATACAGGAGAAAAGG - Intergenic
1024553274 7:50581492-50581514 CATTTGTTTTAAAGGAGAAAGGG - Intergenic
1024907807 7:54408271-54408293 CTGTGCTTTTGGAGGAGAAGAGG + Intergenic
1025121601 7:56308701-56308723 CTGTTGTGGTGTAGGGGGAAGGG - Intergenic
1026152768 7:67802319-67802341 GTGTTTTGTTGTAGGGGAAATGG + Intergenic
1026477262 7:70747655-70747677 TTTTTGTTTTGTAGTAGAGATGG + Intronic
1026587946 7:71672098-71672120 CTTTTATTTTGGAGAAGAAAAGG - Intronic
1026818209 7:73528883-73528905 CTTTTGTTTTTTAGTAGAGACGG + Intergenic
1027430039 7:78102547-78102569 CTGTCTTTTTGTGGGGGAAAGGG - Intronic
1027637203 7:80690088-80690110 GTGATCCTTTGTAGGAGAAAAGG - Intergenic
1027764267 7:82320416-82320438 CTGTGGTTTTGAGGGAGACAGGG + Intronic
1027975468 7:85148272-85148294 AAGTTGTTTTGTAAGTGAAAAGG - Intronic
1028414949 7:90569738-90569760 CTTTTCACTTGTAGGAGAAAAGG + Intronic
1028927738 7:96377916-96377938 CTCTTGTTTTGTTGGGGAAGGGG - Intergenic
1030220927 7:107098567-107098589 GTGTTCTTTTGGAGGAGAAGAGG + Intronic
1030335140 7:108317737-108317759 TTTTTGTTTTGTAGTAGAGACGG - Intronic
1031574889 7:123403650-123403672 CTGTTCCTTTGGAGGAGAAGAGG + Intergenic
1032206622 7:129871542-129871564 TTTTTGTATTGTAGGAGAGATGG - Intronic
1032373169 7:131380937-131380959 CTGTATTTTTCTAGGAGCAATGG - Intronic
1033110753 7:138572920-138572942 CTGTTGTTTTGTAGGAGAAAAGG - Intronic
1034384067 7:150723517-150723539 CTGTTCTGTAGCAGGAGAAAAGG - Exonic
1035191639 7:157174452-157174474 CTTTTGTTTTTTTGGAGACAGGG + Intronic
1036009049 8:4700242-4700264 CTCTTGTTTTCTAGCAGGAAAGG + Intronic
1036542214 8:9727438-9727460 TTGTTGTTTTTTACGAGACAAGG + Intronic
1036688168 8:10925234-10925256 CTGTTGTTCTGGAGGAGGAAAGG + Intronic
1037854005 8:22356668-22356690 CGGTTATTTTGCAAGAGAAAGGG - Exonic
1038159594 8:25024072-25024094 TTGTTGTTTTGAAAGAGAAGGGG + Intergenic
1038328862 8:26591906-26591928 GTGTTGAGTTGTAGGGGAAAGGG + Intronic
1039077792 8:33708220-33708242 CTTTTTTTTTGTAAGAGACAGGG - Intergenic
1039301755 8:36216974-36216996 GGGTAGATTTGTAGGAGAAAAGG - Intergenic
1039380385 8:37079502-37079524 CTTTTGCTTGGTAGGAGATAAGG - Intergenic
1040410997 8:47153840-47153862 CTGATCCTTTGGAGGAGAAAAGG - Intergenic
1043232232 8:77817558-77817580 CTGTTGTTTTAAAGGAGACTGGG + Intergenic
1044221968 8:89679447-89679469 GTGGTGATTTGGAGGAGAAAAGG - Intergenic
1044836606 8:96301684-96301706 TTTTTGTATTTTAGGAGAAACGG + Intronic
1044933627 8:97273834-97273856 CTCTTGTTTTGTAGATGCAAGGG + Exonic
1045412551 8:101933196-101933218 ATGTTACCTTGTAGGAGAAAAGG + Intronic
1045865115 8:106856442-106856464 TTTTTGGTTTGTGGGAGAAAAGG - Intergenic
1046020492 8:108659145-108659167 CTTTAGTTTTGAAGGAGAAATGG - Intronic
1046483037 8:114848795-114848817 CTGTATTTTTGTGAGAGAAAGGG + Intergenic
1046876183 8:119257187-119257209 CTGTTGTGGTGTGGGAGGAAGGG + Intergenic
1046895272 8:119464615-119464637 TTGTTGTTTTGGAGGAAAGAAGG - Intergenic
1047205476 8:122799801-122799823 CCTTTGCTTTGTAGGAGTAATGG + Intronic
1047402749 8:124559945-124559967 CCTTTCTTTTGTAGGTGAAAGGG - Intronic
1048027062 8:130596727-130596749 ATGTTGTTTTGCAGTATAAATGG - Intergenic
1048085344 8:131171759-131171781 CAGTTGTTTTACAGAAGAAATGG - Intergenic
1048397811 8:134031420-134031442 CTTTTGTTTTGTTTGAGACAAGG + Intergenic
1048734511 8:137483703-137483725 CTGTTGTTTTATAGAAGACCAGG + Intergenic
1051614936 9:18998052-18998074 GTGTTCCTTTGGAGGAGAAAGGG - Intronic
1051740580 9:20248071-20248093 CGGTTATTTAGTAGGAGAACTGG - Intergenic
1052687943 9:31777913-31777935 CATTTGTCTTGAAGGAGAAAGGG - Intergenic
1055998182 9:82184738-82184760 CTGTTGTTTTGAAGATGAGAGGG + Intergenic
1056808571 9:89746724-89746746 CTGGTGTTTTGGTGGAGAAACGG - Intergenic
1056821800 9:89847658-89847680 CTCTTGTTTTGTTGAGGAAAAGG - Intergenic
1057270543 9:93648170-93648192 CTGTTGGTTTGTTGGAGAGAAGG + Intronic
1057407725 9:94788820-94788842 CTGTGGTGCTGGAGGAGAAATGG - Intronic
1057433381 9:95016411-95016433 TTTTTGTTTTTTAGTAGAAATGG + Intronic
1057746035 9:97752131-97752153 CTTTTCTTTTGAAGGAAAAAGGG + Intergenic
1057944526 9:99313654-99313676 TTGTAGTTTTTTAGTAGAAACGG + Intergenic
1058387012 9:104448273-104448295 CTGCTGCTTTGTTGAAGAAAAGG - Intergenic
1059743200 9:117173941-117173963 CTGTTTTTTAGTAAGAGTAAAGG - Intronic
1059753016 9:117266585-117266607 GTGTAGTTATCTAGGAGAAAAGG - Intronic
1060576917 9:124704415-124704437 CTGTTGTTTTTTCAGAGACAGGG + Intronic
1060870551 9:127036463-127036485 CTGTTGTTATGAAGAACAAATGG + Intronic
1186004201 X:5050237-5050259 TTGTTGTTTTATAGGTAAAATGG - Intergenic
1187444543 X:19349548-19349570 CTGTTGTTCTGTGGGGGGAAGGG + Intronic
1187780543 X:22817862-22817884 CCGGTGTTTTGTAGCAAAAAAGG - Intergenic
1188150169 X:26664399-26664421 TTGTTGTTTTTTAAGAGACAGGG + Intergenic
1189509322 X:41646159-41646181 CATTTGTTTTAAAGGAGAAAGGG - Intronic
1189557836 X:42163853-42163875 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
1189587926 X:42479756-42479778 CTCTTATTTTATAGGTGAAAAGG - Intergenic
1190087588 X:47409287-47409309 GTGCTGTTCTGTGGGAGAAAGGG - Intronic
1190223838 X:48530609-48530631 CTTTTGTTTTTTTGGAGACAGGG + Intergenic
1190603668 X:52118537-52118559 CTTTTGTTATTTAGGAGAACTGG - Intergenic
1191125293 X:56947686-56947708 CATTTGTTTTAAAGGAGAAAGGG - Intergenic
1191745577 X:64483418-64483440 CTGTTCCTTTGTAGGAGGAGAGG + Intergenic
1191809408 X:65171092-65171114 GTGTTTTTTTGGAGGAGAAGAGG + Intergenic
1192047511 X:67691569-67691591 CAGTGGTTTTGTAGGATAACAGG - Intronic
1192114187 X:68395273-68395295 GTTTTGTTTTGTTTGAGAAAGGG + Intronic
1193094840 X:77536044-77536066 CTTTTGTTTTTTAAGAGACAGGG + Intronic
1193576945 X:83211255-83211277 GTGTTCCTTTGTAGGAGAAGAGG + Intergenic
1193889426 X:87026318-87026340 CTGTTGTTTTATTGTACAAAAGG + Intergenic
1194993971 X:100573371-100573393 CTTTAATTTTCTAGGAGAAAAGG - Intergenic
1195937021 X:110135227-110135249 CTTTTTTTTTTTAGAAGAAAAGG - Intronic
1196060238 X:111400397-111400419 CTGATGGTTTGTGTGAGAAAGGG - Intronic
1196331392 X:114473603-114473625 CTTTTGTTTGGTAGGAAAACTGG - Intergenic
1197691983 X:129511812-129511834 CATTTGTTTTGTCGGAGACAAGG - Exonic
1197851425 X:130864840-130864862 CTTTTGTATTTTAGTAGAAATGG - Intronic
1198314016 X:135448985-135449007 TTGTTGTTTTGGAGGAAAAAAGG - Intergenic
1200042702 X:153381310-153381332 CTGTTGCTTCCCAGGAGAAAAGG - Intergenic
1201326912 Y:12770912-12770934 CTGTATTTTTGTGGGAGTAAAGG + Intronic
1202246984 Y:22830084-22830106 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
1202399973 Y:24463832-24463854 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
1202470808 Y:25206254-25206276 CATTTGTTTTAAAGGAGAAAGGG - Intergenic
1202594682 Y:26524448-26524470 CTGTTGTTTGGTAGGGGGAGGGG + Intergenic