ID: 1033112884

View in Genome Browser
Species Human (GRCh38)
Location 7:138597986-138598008
Sequence GAGTCTTGTTACGAAGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 47}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033112884_1033112886 0 Left 1033112884 7:138597986-138598008 CCTGAAGCTTCGTAACAAGACTC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1033112886 7:138598009-138598031 CACAATCCAGTAGATGTTACTGG No data
1033112884_1033112887 1 Left 1033112884 7:138597986-138598008 CCTGAAGCTTCGTAACAAGACTC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1033112887 7:138598010-138598032 ACAATCCAGTAGATGTTACTGGG 0: 1
1: 0
2: 1
3: 6
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033112884 Original CRISPR GAGTCTTGTTACGAAGCTTC AGG (reversed) Intronic
905700834 1:40012396-40012418 AAGTCTTGTTAAGAATGTTCAGG + Intergenic
914685868 1:149978563-149978585 GAATCTTGTTATGAACCTTTTGG - Intronic
919462874 1:197899747-197899769 GAGTCCTGTTATGAAGCTCTAGG - Intergenic
1067918659 10:50428769-50428791 CAGTCTTCTTAGGAAGCATCTGG - Intronic
1072068917 10:91897696-91897718 AAGTGTTGTTTCCAAGCTTCCGG + Intergenic
1077361511 11:2142674-2142696 GATTCTTGTTATGAAGCTCCTGG + Intronic
1078381920 11:10850190-10850212 GAGTCTAGTTACCAGGCTTGAGG + Intronic
1080185825 11:29484434-29484456 GAGTCTGGCAAGGAAGCTTCAGG + Intergenic
1082280028 11:50261820-50261842 GGGTCTTCTGAGGAAGCTTCTGG - Intergenic
1085219636 11:74862610-74862632 GACTCTTGTTAAGGAGCTGCTGG + Intronic
1085654844 11:78304555-78304577 GAGCCTGGTTAAGAAACTTCAGG - Intronic
1086239981 11:84678072-84678094 GAGTCTTTTAATGAATCTTCAGG - Intronic
1095952087 12:47787079-47787101 GACTCTGGTCACAAAGCTTCAGG + Intronic
1102622952 12:114211310-114211332 TAGTATTGTTACAATGCTTCTGG - Intergenic
1107989372 13:45803810-45803832 GAGTCTTGTTATGAAGGCTTTGG + Intronic
1117068843 14:52038162-52038184 TTGTCTTGTTCCTAAGCTTCAGG + Intronic
1127799931 15:62469154-62469176 GACTCTAGTCAAGAAGCTTCTGG - Intronic
1137028275 16:35499565-35499587 GGGTCTTGTTACATTGCTTCTGG - Intergenic
1140507523 16:75483174-75483196 GACTCCTGTTCCTAAGCTTCTGG + Intronic
1140514599 16:75532912-75532934 GACTCCTGTTCCGAAGCTCCTGG + Intronic
1147585956 17:41654201-41654223 GGGCCTTGTAAGGAAGCTTCTGG - Intergenic
1150999595 17:70359120-70359142 GAGTCTTGTTTCTTACCTTCAGG + Intergenic
1155168389 18:23249077-23249099 AAGTCCTGTCACTAAGCTTCTGG - Intronic
1155235152 18:23811392-23811414 GATTCTGGTTAGGAAGATTCTGG - Intronic
1166025933 19:40084653-40084675 AATTCTAGGTACGAAGCTTCAGG + Intronic
1166740720 19:45113301-45113323 GATTCCTGTTACGAATCTACAGG - Intronic
926255795 2:11196364-11196386 CACTCTTGTTATGAAACTTCAGG + Intronic
926886351 2:17602271-17602293 GAGGGTTGTTATGAAGCTTGTGG + Intronic
928442211 2:31301936-31301958 TAGTCTTGTGAAGAAGCATCAGG - Intergenic
931931633 2:67143941-67143963 GAGTCTTGTTAGCAAAGTTCTGG + Intergenic
932930243 2:76027627-76027649 TACTCTTGTTACAAACCTTCAGG + Intergenic
937037268 2:118792601-118792623 GAGGCTTGTTAGGGAGCTTGAGG + Intergenic
937825402 2:126363742-126363764 GAGTCATATTACAAAGCTTCTGG - Intergenic
1176022208 20:62967629-62967651 GACTCTTCTTAAGGAGCTTCAGG - Exonic
1183279699 22:36925319-36925341 GAGCCCAGTTACGAGGCTTCTGG - Intronic
1183283909 22:36950968-36950990 GAACCCTGTTAGGAAGCTTCTGG + Intergenic
966043040 3:175515604-175515626 GAGTCTTGTTAGAAAGCTGGAGG + Intronic
979318926 4:119300542-119300564 TAGGGTTGTTACGAAGCTGCAGG - Exonic
980259622 4:130431942-130431964 TAGTCTTTTTACGCAGCTCCAGG - Intergenic
991322506 5:65390425-65390447 GAATCTAATTACAAAGCTTCAGG + Intronic
994585167 5:101698532-101698554 AAGTCTTCTTACGTACCTTCAGG - Intergenic
1007970224 6:46044519-46044541 CAGTATTGTTACAAACCTTCAGG + Intronic
1016634452 6:146271426-146271448 GAGACTTGTTAGGAAGCTGGTGG + Intronic
1029942770 7:104497724-104497746 GAGTCTGGTTAGGAATCTTTTGG + Intronic
1033112884 7:138597986-138598008 GAGTCTTGTTACGAAGCTTCAGG - Intronic
1036659752 8:10700333-10700355 GAGTCTTCTTCTGAAGCTTCAGG - Exonic
1039386108 8:37137022-37137044 CAGCCTTGTTTCAAAGCTTCCGG - Intergenic
1041486134 8:58378539-58378561 TAGTCTTGTTACTAAGCTAGTGG + Intergenic
1046531051 8:115445277-115445299 GCTTCTTCTTAAGAAGCTTCAGG + Intronic
1047178617 8:122566288-122566310 TAGACTTGTTAGGAAGCTGCAGG + Intergenic
1194924138 X:99804170-99804192 GAGTCTGGTTCCAAAGCTTGAGG - Intergenic