ID: 1033113368

View in Genome Browser
Species Human (GRCh38)
Location 7:138603391-138603413
Sequence CAGCTAAAGCAGGCCGGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033113363_1033113368 16 Left 1033113363 7:138603352-138603374 CCTGCTGACACTGAATAGGGTGT 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1033113368 7:138603391-138603413 CAGCTAAAGCAGGCCGGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033113368 Original CRISPR CAGCTAAAGCAGGCCGGGTG CGG Intronic
No off target data available for this crispr