ID: 1033113987

View in Genome Browser
Species Human (GRCh38)
Location 7:138609210-138609232
Sequence GCAACAAGGCTCTCAGGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033113982_1033113987 28 Left 1033113982 7:138609159-138609181 CCAGTGAGATTGGCAAAGATGAA 0: 1
1: 0
2: 7
3: 53
4: 568
Right 1033113987 7:138609210-138609232 GCAACAAGGCTCTCAGGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033113987 Original CRISPR GCAACAAGGCTCTCAGGCAC TGG Intronic