ID: 1033116797

View in Genome Browser
Species Human (GRCh38)
Location 7:138632621-138632643
Sequence CAGAGGAAGTAGGATGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 587
Summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 532}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033116797 Original CRISPR CAGAGGAAGTAGGATGTGGA GGG Intronic
900025247 1:266781-266803 CAGAGGCTGTAGAATGTGCACGG + Intergenic
900028849 1:356163-356185 CAGAGGCTGTAGAATGTGCACGG + Intergenic
900149080 1:1170494-1170516 GAGAGGAAGGAGGAGGGGGAGGG - Intergenic
900751514 1:4400844-4400866 CAGAGAAAGAGGGATGGGGAAGG - Intergenic
900862861 1:5245492-5245514 AGGAGGGAGTGGGATGTGGAGGG + Intergenic
901149738 1:7093274-7093296 CCCAGGCAGTAGGATGTGGCTGG + Intronic
901909634 1:12445828-12445850 CAGAGGAGGTAGAATGGGAATGG - Intronic
902290509 1:15431836-15431858 CAGAGAAAGCAGGTTGAGGAGGG + Intergenic
902676442 1:18011879-18011901 CAGAGTAGGTAGCATGTGGGAGG - Intergenic
903134297 1:21299237-21299259 CAGAGGGAGGAGGAAGTGGGTGG + Intronic
903322660 1:22552192-22552214 CAGAGGGACTGGGAAGTGGAGGG + Intergenic
903332002 1:22601223-22601245 CAGAAGAAGCAGGCTGAGGAAGG - Intronic
903363207 1:22790121-22790143 AAGAGTGAGTAGGATTTGGATGG + Intronic
903704082 1:25272360-25272382 CAGAGGGACTATGATGGGGAGGG - Intronic
903723154 1:25420952-25420974 CAGAGGGACTATGATGGGGAGGG + Intronic
903804189 1:25992509-25992531 CAGAGTAAGTATGATGATGATGG - Intronic
904012554 1:27398189-27398211 CAGGGGAAGAAGGATGGGGAGGG + Intergenic
904087193 1:27917140-27917162 AAGAGGAAGGAGGAAGGGGAAGG - Intergenic
904946797 1:34205273-34205295 CAGCTGAAGTTGGCTGTGGAAGG + Intronic
905084838 1:35363591-35363613 CAGTGGAAGTTGGATGTGTTAGG + Intronic
905817908 1:40966221-40966243 CAGAGGAACTGGGATGAGAATGG + Intergenic
906175434 1:43767308-43767330 CAGGGGAAGATGGATGTGGCTGG + Intronic
906216330 1:44043204-44043226 CAGAGGAAATGGGAGCTGGAGGG + Intergenic
906269609 1:44465301-44465323 GAGAGGAATTAGGATTGGGAAGG - Intronic
906542156 1:46595413-46595435 CAGAGGAAGGAGGCAGTGGGTGG - Intronic
906741425 1:48189100-48189122 CAGAGGAAGCAAGCTGTGCAGGG + Intergenic
907913297 1:58846101-58846123 CAGAGGAAACAGCATGGGGAAGG - Intergenic
908163709 1:61436997-61437019 CTGAGGAAGGAGGGTGTTGAGGG - Intronic
908372318 1:63495576-63495598 CAAAGAAAGTAGGATGGGGCAGG + Intronic
908514072 1:64874554-64874576 CAGAGGAAGTTATATATGGAAGG - Intronic
909507750 1:76413130-76413152 CAGAGGAAATAGGAGAAGGAAGG - Intronic
911809708 1:102260424-102260446 GAGAGGAAGTACGAAGAGGAGGG + Intergenic
911905778 1:103567203-103567225 CACACTAAGTTGGATGTGGAAGG + Intronic
912959074 1:114179372-114179394 GAGAGGAAGAGGGATGAGGAAGG - Intergenic
913568879 1:120100779-120100801 AAGAGGAAGTTGGGTGTGGCAGG - Intergenic
914220704 1:145679434-145679456 TAGAGGAAGTGGGATGTGTAAGG - Intronic
914289688 1:146261770-146261792 AAGAGGAAGTTGGGTGTGGCAGG - Intergenic
914473283 1:148002307-148002329 TAGAAGAAGTGGGATGTGTAAGG - Intergenic
914550732 1:148712553-148712575 AAGAGGAAGTTGGGTGTGGCAGG - Intergenic
915087578 1:153398586-153398608 CAGAGGAAGTGGGGAGTGGGAGG - Intergenic
915320869 1:155055867-155055889 CAGGGGGAGGAGGATGTGCAGGG - Intronic
915368068 1:155326438-155326460 GAGAGGAGGAAGGATGTGGTGGG - Intronic
915570735 1:156743893-156743915 CAGAGGAAGTGGGCTGAGGCTGG + Intronic
916052990 1:161049095-161049117 GAGAGGCAGCAGGATGTGGAAGG - Exonic
916577819 1:166082767-166082789 CAGAGGGAGTAAGATGGGGAAGG + Intronic
917485776 1:175453369-175453391 CATAGAAAGTTAGATGTGGAAGG + Intronic
919864774 1:201772476-201772498 CATAGGAAGTAGGAGTGGGATGG + Intronic
919940865 1:202285112-202285134 CAGAGGAGATTTGATGTGGAAGG - Intronic
921188209 1:212687558-212687580 CAGAACAAGTTGGATATGGATGG - Intronic
922216943 1:223527410-223527432 CAAAGAAAGAAGGATATGGAGGG + Intergenic
922289292 1:224197305-224197327 CAGGAGAATTAGGATGTGGCTGG + Intergenic
922505941 1:226125679-226125701 CAGAAGATGCAGGATTTGGACGG + Intergenic
922596307 1:226816113-226816135 CAGAGGAAGGAAGATGGGGCAGG - Intergenic
922783744 1:228272973-228272995 CACAGGCAGTAGGACGTGAAGGG - Intronic
922900146 1:229130247-229130269 CAGAGGACTCAGGATGTGGTTGG + Intergenic
1062947375 10:1471888-1471910 CATAGGAAGGGGGATGTGGAGGG - Intronic
1063243129 10:4191951-4191973 CAGAGAAAGTAGCATGTTTAAGG + Intergenic
1064927274 10:20582691-20582713 CAGAGAAAGTAGGAGGAGGGGGG - Intergenic
1065047048 10:21754188-21754210 CAGTTGAAGTAGGATGGGGTGGG - Intergenic
1065973684 10:30824502-30824524 CAGAAGAAGGAGGAGATGGAGGG - Intronic
1066709998 10:38223241-38223263 CAGAGAAAATAGGTTTTGGAAGG - Intergenic
1066980012 10:42404213-42404235 CAGAGAAAATAGGTTTTGGAAGG + Intergenic
1067501055 10:46805762-46805784 CAGAGGGAGTGGGAAGTGGTGGG + Intergenic
1067593526 10:47534153-47534175 CAGAGGGAGTGGGAAGTGGTGGG - Intronic
1067640635 10:48042257-48042279 CAGAGGGAGTGGGAAGTGGTGGG - Intergenic
1067691528 10:48505011-48505033 CAGAGAAAGCAGGGTGTGGTGGG - Intronic
1067984865 10:51131623-51131645 CAGTGGAAGATGAATGTGGAAGG + Intronic
1068655786 10:59575300-59575322 CACAAGAAGTAAGATCTGGAAGG - Intergenic
1069987326 10:72293308-72293330 AAGAGGAAGCAGAATGGGGAGGG - Intergenic
1070137598 10:73708286-73708308 CAGAGGGAGTGGGAAGTGGTGGG - Intergenic
1070826875 10:79395990-79396012 AAGTGGGAGTAGGATGGGGAAGG - Intronic
1070841831 10:79492732-79492754 TAGAGGTAGTAGGAGCTGGAGGG - Intergenic
1071224813 10:83516447-83516469 TAGAGGCAGTATGGTGTGGAGGG + Intergenic
1071494142 10:86156199-86156221 CAGAGGAAGACGGATGTGCTGGG - Intronic
1071681610 10:87711748-87711770 CAGAGGAAGGAGGATTTGGGTGG - Intronic
1071943766 10:90617144-90617166 CAGAGGAAGTCGGGGGTGAAGGG + Intergenic
1072306092 10:94108636-94108658 CAGGGGAAGCAGGGGGTGGAGGG - Intronic
1072530503 10:96314216-96314238 CAGAGGGAGTAACATCTGGATGG - Intronic
1073127511 10:101160869-101160891 CAGAGGAAGATGGATGTGGCAGG - Intergenic
1074289390 10:112127025-112127047 CAGAGGAAGGTGGACATGGAAGG + Intergenic
1074950757 10:118332518-118332540 GAGGGGCATTAGGATGTGGAGGG - Intronic
1075081475 10:119386816-119386838 CAGAGGAGGGAGGAGGTGGCGGG + Intronic
1075341149 10:121647776-121647798 CAGAGGATTTAGGATGTGGAGGG + Intergenic
1075564172 10:123491729-123491751 CAGGAGAAGTAGGATGTAAAAGG + Intergenic
1075855985 10:125630768-125630790 CAGTGGAAGTGGGAAGGGGAGGG - Intronic
1076693263 10:132234561-132234583 CACAGGATGCAGGGTGTGGAGGG - Intronic
1078897437 11:15609428-15609450 CAGAGCCAATAGGATGTGAAAGG + Intergenic
1079060496 11:17244619-17244641 CAAAGGAAGAAGGGTGGGGAGGG - Intronic
1079333417 11:19551691-19551713 GAGAGGAAGCAGGACGTGGCTGG - Intronic
1079360281 11:19765323-19765345 AAGAGGAGGAAGGATGAGGAAGG - Intronic
1080635619 11:34120955-34120977 CAGAGGAAGCAGCATGTGCATGG + Intronic
1080754703 11:35185614-35185636 AAGAGGAAGAAGGAGATGGATGG - Intronic
1083678595 11:64341188-64341210 CAGAGGCAGGAGGGTGTGGGTGG - Intronic
1084125908 11:67098879-67098901 CAGAGGACATGGGGTGTGGAGGG - Intergenic
1084272592 11:68037138-68037160 CACAGGAAAGAGGATGTGGCTGG - Intergenic
1084365359 11:68694010-68694032 TAGAGCAAGTAGGAGGTGGACGG - Intergenic
1084461850 11:69300601-69300623 AGGAGGGAGTAGGGTGTGGAAGG + Intronic
1084580772 11:70021815-70021837 CACAGGCAGTGGGATGTGAAGGG - Intergenic
1084639283 11:70414823-70414845 GAGAGGAAGCAGGATGCGGCGGG + Intronic
1085767159 11:79293282-79293304 CAGAAAAAGTAGGATGGGCACGG + Intronic
1085896556 11:80647006-80647028 AAGAGGAAGAAAGTTGTGGAAGG - Intergenic
1085932555 11:81101933-81101955 CAGAGGAAGTAGCAGATGGAAGG - Intergenic
1086251034 11:84814559-84814581 CAGAGTATGAAGGCTGTGGAGGG - Intronic
1087629796 11:100636731-100636753 CAGAGGAGCTAGGATATGAATGG + Intergenic
1088693667 11:112348592-112348614 CAGAACCAATAGGATGTGGATGG - Intergenic
1089224046 11:116900633-116900655 GAGAGGAAATAGCATGTGGAAGG - Intronic
1089232306 11:116989771-116989793 CACATGAAGTAAGATGTGGTTGG + Intronic
1089459052 11:118642123-118642145 AAGAGGAAGAAGGAAGGGGAAGG - Intronic
1089892333 11:121894048-121894070 CAGGGGATGTCGGAAGTGGATGG + Intergenic
1090150245 11:124376589-124376611 CAGAGGAAGTCGGGGGTGAAGGG - Intergenic
1091067043 11:132524363-132524385 CCCAGGAAGTAGGATGATGATGG - Intronic
1091310764 11:134573706-134573728 CAGAGGAGGCAGGAAGGGGATGG + Intergenic
1094020002 12:25904123-25904145 GAAAAGAAGTGGGATGTGGAAGG + Intergenic
1094287537 12:28812283-28812305 CAGAGGAAGTCAGAGGTGAAGGG - Intergenic
1095426820 12:42083844-42083866 CAGTGGAGGTTGGAAGTGGAGGG - Exonic
1095648546 12:44578885-44578907 CAGAGAAAGTAGGCTTTTGAAGG - Intronic
1096562460 12:52446494-52446516 CTGATGGAGTAGGCTGTGGAGGG + Intergenic
1097221887 12:57455909-57455931 CAGAGGGAGTGGGGTGTGGCAGG + Intronic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1099877515 12:88427414-88427436 CAGAGGCAGGAGTATGGGGAAGG + Intergenic
1101152040 12:101891936-101891958 CAGAGGTAGTAGTATTTGGGTGG - Intronic
1102679816 12:114683867-114683889 CAGAGGAAGGAGGAGGAGGGCGG - Intronic
1103478903 12:121238255-121238277 CAGAGGAAATGGGAAGTGGATGG + Exonic
1104476978 12:129078711-129078733 CAGAGGAGACAGGATCTGGAGGG + Exonic
1105738332 13:23295708-23295730 GAGAGGAAGAAGGAGGAGGAAGG - Intronic
1105784853 13:23738556-23738578 CTGAGGAAGGCGGAGGTGGAAGG - Intronic
1107526110 13:41233283-41233305 TAGAGGAAGTAGGAAGAGGGTGG + Intronic
1108105871 13:47008459-47008481 CAGAGGGAGGAGGAGGAGGAGGG + Intergenic
1108167420 13:47708157-47708179 CAGGGTAAGGAGGATCTGGAAGG - Intergenic
1108370683 13:49764449-49764471 GAGAGGAAGGACGATTTGGAAGG - Intronic
1108407003 13:50114566-50114588 CTGAGGATGCAGGATATGGAGGG - Intronic
1108633687 13:52311742-52311764 CATAGAAAGTATGATGTGTAGGG - Intergenic
1108813334 13:54258231-54258253 GAGAGAAAGAAGGAAGTGGAAGG - Intergenic
1109932991 13:69242125-69242147 CAGACCCAGTAGGATGTGTAGGG + Intergenic
1110317837 13:74131972-74131994 TAGTGGAAATAGGATGTTGAAGG - Intronic
1110700383 13:78540620-78540642 AAGAAGAAGGAGGATGGGGAGGG - Intergenic
1110924799 13:81137991-81138013 CAGAGGAAGTGGGAGGGGGAAGG - Intergenic
1111294374 13:86259789-86259811 AAGAGGAAAAAGGATATGGATGG + Intergenic
1111647727 13:91051732-91051754 TAGAGGAAATAGGACGTGGCTGG - Intergenic
1111697455 13:91642651-91642673 CAGTGGGAGTAAGAAGTGGAAGG + Intronic
1112002909 13:95228380-95228402 CAGACTGAGTAGGAAGTGGAAGG - Intronic
1112018916 13:95354594-95354616 CAGAGCAGGTAGAATGTGGAAGG - Intergenic
1112781620 13:102906932-102906954 TAGAGGAAGATGGATGGGGAAGG - Intergenic
1112901725 13:104365180-104365202 CAGGGGAGATAGGATGTGGCTGG - Intergenic
1113309587 13:109118039-109118061 CAGAGAAACTAGCATGTGAAAGG - Intronic
1113815185 13:113164692-113164714 AGAAGGAAGGAGGATGTGGACGG - Intronic
1113878525 13:113609279-113609301 CAGGTGAGGTAGGATGTGCAGGG - Intronic
1114054434 14:18954596-18954618 CAGGGGAAGGAGGAGATGGAAGG - Intergenic
1114108120 14:19447336-19447358 CAGGGGAAGGAGGAGATGGAAGG + Intergenic
1114429019 14:22644674-22644696 CAGAGGAAGAAGCAGGTTGATGG - Intergenic
1115466965 14:33725963-33725985 AAGAGAAAGTGGGAGGTGGAGGG - Intronic
1115704634 14:35986497-35986519 TAGGGGGAGCAGGATGTGGATGG + Intergenic
1118127239 14:62920193-62920215 CTTAGGAAGAATGATGTGGAGGG + Intronic
1118223110 14:63873809-63873831 CAAAGGAAGTAGAAAGTGAATGG + Intronic
1120897629 14:89547990-89548012 GAGAGAAAGTAGGAGGTGGAAGG + Intronic
1121081936 14:91115312-91115334 CTGAGGAAGCAGGAAGGGGAAGG + Intronic
1121406292 14:93721179-93721201 GACAGGGAGGAGGATGTGGAGGG + Exonic
1121414609 14:93770484-93770506 CAGAGGAAACAGCATGTGCAAGG - Intronic
1121437678 14:93929746-93929768 CAAAGGAAGGAGGGTGAGGAGGG + Intergenic
1121735718 14:96216714-96216736 AAGAGGAAGGAGGAGGAGGAAGG + Intronic
1122966036 14:105126494-105126516 GAGAGGAAGAAGGATGAGGAAGG + Intergenic
1122987000 14:105217109-105217131 CTGAGGAAGGAGGATGTGGGTGG - Intronic
1124207362 15:27732926-27732948 CAGATGAAGAAGGATGTAAATGG - Intergenic
1126244295 15:46486139-46486161 GAGAGGAAGCAGGATGTGCAAGG - Intergenic
1127278922 15:57472230-57472252 CAGAGGAAATAGCATGTGCAAGG + Intronic
1127402372 15:58602334-58602356 GAGTGCAAGTAGGATGAGGAAGG - Intronic
1127501864 15:59561225-59561247 AGGAGGATGTAGGATATGGATGG + Intergenic
1127699128 15:61479990-61480012 CAGAGGAAATAGCAAGTGCAAGG + Intergenic
1127799185 15:62462921-62462943 CATAGGGAGGAGGATGTGGAAGG + Intronic
1128105406 15:65040651-65040673 AAGAGGAATGAGGAAGTGGAGGG + Intergenic
1128137877 15:65277394-65277416 CAGGGTAAGTAAGATGTGGTTGG - Intronic
1128732482 15:70030656-70030678 CAGAGGGAGAAGGAGGTGGCTGG - Intergenic
1129263072 15:74379812-74379834 CAGAGGAGGCTGGATGTGGTAGG - Intergenic
1129295826 15:74599526-74599548 CGGAGGAAGCAGGCTGAGGAGGG + Intronic
1130024119 15:80256447-80256469 CAGAGGCAGCAGGAGGTGCATGG - Intergenic
1130117187 15:81015396-81015418 GGGAGCAGGTAGGATGTGGAAGG - Intronic
1131014151 15:89043506-89043528 AAGAGGAAGGAGGAAGAGGAGGG + Intergenic
1131671113 15:94620344-94620366 AAGATGAAGAAGGCTGTGGAGGG - Intergenic
1131861089 15:96653794-96653816 CAGATGAAGGAGGTAGTGGAGGG + Intergenic
1132014986 15:98307572-98307594 AAGAGGAAGGTGGAAGTGGATGG + Intergenic
1132157222 15:99504083-99504105 CAGAGAAGGTGGGATGTGCACGG + Intergenic
1133012539 16:2922469-2922491 CAGGGGCAGGAGGATGAGGAGGG - Intronic
1133149752 16:3818736-3818758 CAGAGGAAGTGGGCTTTGGGGGG + Intronic
1133546711 16:6814676-6814698 CACAGGGAGCAGCATGTGGAAGG + Intronic
1133691026 16:8215318-8215340 CAGAGGAAGAAGGGTGTTTATGG + Intergenic
1133721492 16:8498613-8498635 AAGAGGAAGGAGTTTGTGGAAGG - Intergenic
1134021352 16:10923563-10923585 CTGAGGCTGTGGGATGTGGATGG - Intronic
1134903820 16:17962118-17962140 CCGCGGCAGTAGGCTGTGGAAGG + Intergenic
1135054570 16:19220191-19220213 CAGATGAGGTATGATGTGAAGGG + Intronic
1135124371 16:19795949-19795971 AAGAGGAAAAAGGATATGGATGG - Intronic
1136574254 16:31113873-31113895 TAGGGGAAGTAGGAAGGGGAAGG + Intergenic
1136631945 16:31493948-31493970 CAGAGGGAGAAGGAGTTGGAAGG + Intronic
1139686177 16:68605425-68605447 CAGAGGAAGTAGAGTGTGGAAGG - Intergenic
1139939458 16:70594764-70594786 CAGAGGAAACAGGTTTTGGAAGG + Intronic
1139946317 16:70644861-70644883 AGGAGGAAGTAGGAAGAGGAAGG + Intronic
1139946325 16:70644890-70644912 AAGAGGAAGGAGGAAGAGGAGGG + Intronic
1140402100 16:74679888-74679910 TACAGGAAGTAGGATGGCGAAGG + Intronic
1140478107 16:75249028-75249050 CAGAGGAGGTGGCATGGGGAGGG + Intronic
1140743201 16:77959948-77959970 CAGAGGAAGTGGAATGTGACAGG - Intronic
1141036504 16:80630851-80630873 CATAGGAAGTGGGGTGGGGAGGG - Intronic
1141230951 16:82167247-82167269 AAGAAAAAGAAGGATGTGGATGG - Intronic
1141714019 16:85716650-85716672 CAGAGGGAGAAGGAGGAGGAAGG + Intronic
1142994048 17:3750635-3750657 CAGAGGAAGTGGCATTTGGATGG + Intronic
1143362728 17:6384704-6384726 GAGAGGATGTGGGATGTGGAGGG - Intergenic
1143555661 17:7658244-7658266 CAGAGGAGGTAGCATTTGAACGG + Intergenic
1144070196 17:11664591-11664613 CTGAGGAAGGAGGATGGGGTTGG - Intronic
1144126806 17:12210497-12210519 GAGAGGAAGAAGGAAGAGGAAGG - Intergenic
1144419050 17:15079260-15079282 TAGAGGAAACAGGATGTGCAAGG + Intergenic
1144783341 17:17818662-17818684 CAGAGAAAGCAGGAAGAGGATGG - Intronic
1146954479 17:36929266-36929288 CAGAGGAGGTCGGAGCTGGAAGG + Intergenic
1147112958 17:38277451-38277473 CAGAGGAAGGAGAATGGGGTGGG - Intergenic
1147326370 17:39671653-39671675 CAGAGGAAGGAAAATGGGGATGG - Exonic
1147360582 17:39927363-39927385 CAGAGGGAGTGGGGGGTGGAGGG - Intronic
1147440672 17:40445470-40445492 CAGAGGATTGAGGAAGTGGAGGG - Intronic
1147914566 17:43878776-43878798 CATAGGAAGGAGGATGGGGCTGG + Intronic
1148088907 17:45010830-45010852 GAGAGGAAGAAGGATGTTGCAGG + Intergenic
1148416663 17:47511774-47511796 CAGAGGAAGGAGAATGGGGTGGG + Intergenic
1149451300 17:56751974-56751996 CAGAGAAAGAAGGATTTGGTGGG + Intergenic
1149663354 17:58348409-58348431 CTGAGAATGTAGGATTTGGATGG - Intronic
1152000090 17:77639931-77639953 AAGAGGAAGAAGGAGGAGGAGGG - Intergenic
1152950909 17:83230394-83230416 CAGAGGCTGTAGAATGTGCACGG - Intergenic
1153938882 18:9959136-9959158 CAGAGAAAGTGGGATCTAGATGG + Intronic
1155069055 18:22297188-22297210 CTGAGTAAGTAGGCTGTGGTCGG - Intergenic
1155870838 18:31026184-31026206 CAGAGAAAATAGGAAGTGCAAGG + Intronic
1156509257 18:37621793-37621815 GAGAGTAAGGAGGATGTGAAAGG + Intergenic
1157477269 18:48031384-48031406 CAGGAGCAGTGGGATGTGGAGGG - Intronic
1158099965 18:53819533-53819555 CAGTGGAGATAGGCTGTGGATGG - Intergenic
1158346363 18:56520681-56520703 CTGAGGGAGAGGGATGTGGAAGG + Intergenic
1158731162 18:60023961-60023983 CAGAGTAAGTAGGATGGGTCAGG + Intergenic
1158742657 18:60161687-60161709 CAGGGGCAGTAGGGTGTTGATGG - Intergenic
1160281673 18:77496607-77496629 CAGAGGAAGTAGGAAGGAGCTGG - Intergenic
1160749388 19:726908-726930 CAGAGGAAGCAGGATCGGGCTGG + Intronic
1161030716 19:2056662-2056684 GAGAGGAGGAAGGATGAGGAGGG - Intergenic
1161204408 19:3033592-3033614 CAGAAGAAGGAAGATCTGGAGGG - Intronic
1161285267 19:3465128-3465150 AAGAGGAAGTGGGGGGTGGAGGG - Intronic
1161360139 19:3843997-3844019 GACAGAAAGTAGGATGTGGGGGG + Intronic
1161588387 19:5117711-5117733 CACAGGGAGCAGGAGGTGGATGG - Intronic
1161715777 19:5875496-5875518 CAGAAGAGAAAGGATGTGGAAGG + Intronic
1162017062 19:7851646-7851668 CAAAGGCAGTGGGAGGTGGAGGG - Intronic
1162222140 19:9186655-9186677 CTGAGGAACAAGGATGTGAAGGG + Exonic
1162225006 19:9213942-9213964 CTGAGGAACAAGGATGTGAAGGG - Exonic
1162227527 19:9236017-9236039 CTGAGGAACAAGGATGTGAAGGG + Intergenic
1162393078 19:10401404-10401426 CAGAGGGAGGAGGGTGTGGCAGG + Intronic
1162440034 19:10687215-10687237 CAGAGGCAGTAGGACAAGGAGGG - Intronic
1163479157 19:17544463-17544485 CAGTGGAGGGAGGAGGTGGATGG + Intronic
1165478448 19:36046488-36046510 CAAAGGAAGATGGAGGTGGAGGG + Intronic
1165742159 19:38210885-38210907 CAGGGGAAGAAGGAGGTGGATGG + Intergenic
1166379962 19:42350693-42350715 AAGAGGAAGCAGGGTGTCGAGGG - Intronic
1167214211 19:48153711-48153733 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214224 19:48153793-48153815 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214236 19:48153871-48153893 AAGAGGAAGAAGGAGGAGGAAGG - Exonic
1167591952 19:50408992-50409014 CAGAGATAGTAGGGAGTGGAGGG + Intronic
1167838761 19:52096644-52096666 GAGAGGAAGTAACTTGTGGAAGG - Intergenic
1168539242 19:57196773-57196795 CTGGGGAAGAGGGATGTGGATGG - Intronic
924994179 2:341649-341671 CAGAGGAAGAAAGCTGTGGTTGG + Intergenic
925671210 2:6311603-6311625 CTGAGGATTTATGATGTGGAAGG + Intergenic
925738586 2:6985552-6985574 CTTAGGAAGGTGGATGTGGAAGG + Intronic
925869861 2:8260644-8260666 CATAGGAAGTTGAATGTGGAAGG - Intergenic
926584503 2:14671540-14671562 CAAAGGGAGTAGGAACTGGAAGG + Intergenic
926935748 2:18085379-18085401 CAGAGGAAGGAGGATGCCAAGGG + Intronic
927391461 2:22600133-22600155 CTGTGGAACTAGGAGGTGGAGGG + Intergenic
928324959 2:30311940-30311962 CAGAGCCAGAAGGATGTTGAGGG - Intronic
928458740 2:31449911-31449933 CAGAGGAGGTAGCATGGGGCAGG + Intergenic
929962464 2:46506961-46506983 CAGAGGCAGGAGGCTCTGGAGGG - Intronic
930140348 2:47945163-47945185 CAGAGTAGGAAGGGTGTGGAAGG - Intergenic
931234786 2:60404041-60404063 CAGAGGGAGCTGGATGTGGCTGG - Intergenic
931316834 2:61140854-61140876 CAGAGGAAGGAATAGGTGGAAGG + Intergenic
932385268 2:71326563-71326585 CAGAGGAAGAATGAAGAGGAAGG - Intronic
932435387 2:71700168-71700190 CAGAGGGAGTAGCATGGGGCGGG - Intergenic
932469467 2:71944452-71944474 CACATGGAGTATGATGTGGATGG - Intergenic
932660114 2:73644307-73644329 CACAGGGAGGAGGATGAGGAAGG + Intergenic
932666681 2:73703988-73704010 CACAGGGAGGAGGATGAGGAAGG + Intergenic
933786544 2:85847340-85847362 CAGAGGAAGTGAGATTTGGAAGG - Intronic
933925903 2:87091037-87091059 GAGAGGAGATAGGAGGTGGAAGG - Intergenic
933940384 2:87240103-87240125 CAGAAGAAGATGGATGTAGACGG - Intergenic
934793009 2:97078907-97078929 CAGAGGATGGAGGGTGAGGAGGG - Intergenic
934813178 2:97301578-97301600 CAGAGGATGGAGGGTGAGGAGGG + Intergenic
934824517 2:97406902-97406924 CAGAGGATGGAGGGTGAGGAGGG - Intergenic
935079486 2:99778199-99778221 CAGAGGAAGGAGGAGGAGAAGGG - Intronic
935170313 2:100606491-100606513 CAGAGAAAGGAGGCTGGGGAGGG - Intergenic
935327372 2:101948972-101948994 AAGAGGAAGTAGGTTGTTGGTGG - Intergenic
935545173 2:104393550-104393572 CAGAGAAAGTTGGATTTTGAGGG - Intergenic
936352753 2:111725673-111725695 CAGAAGAAGATGGATGTAGACGG + Intergenic
936496001 2:113021553-113021575 AAGAGGAACTAGGATCTGGGGGG + Intergenic
936666185 2:114598454-114598476 CAGAGGTAGCAGGAAGTAGAAGG + Intronic
938089944 2:128424869-128424891 CAGAGGAAGTTGATAGTGGAAGG + Intergenic
938396176 2:130950102-130950124 CAGCTGAAGGAGGATGAGGAAGG + Intronic
938637719 2:133247804-133247826 AATAGAAAATAGGATGTGGAAGG - Intronic
938793954 2:134702843-134702865 AATAGGAAGTAGGGTGTGTATGG + Intronic
939144257 2:138393906-138393928 CAGAGGAAGGTGAATGCGGAAGG - Intergenic
939326207 2:140691999-140692021 CAGAGAAAGCAAGATGTTGATGG + Intronic
939794344 2:146622990-146623012 CAGATGAAGTAGGAAAGGGAAGG - Intergenic
941584667 2:167342684-167342706 CAGAGGAACAAGGATGGGGAGGG - Intergenic
941751686 2:169141307-169141329 CAGAGGAAGAGGGATGAGGATGG - Intronic
942208596 2:173648226-173648248 CAGAGAAAGCAGGACGGGGAGGG + Intergenic
942570399 2:177308480-177308502 CATTGGGAGTAGGATGAGGATGG - Intronic
943670937 2:190659597-190659619 CAGGGGAAGTCAGATGTGGTTGG + Exonic
943805630 2:192121447-192121469 GAGGGGAAGGAGGAGGTGGAAGG + Intronic
945965597 2:216183159-216183181 CACAGGAAGAATGATATGGAAGG - Intronic
946699458 2:222397163-222397185 GAGAGGAAGAATGATGAGGAGGG - Intergenic
946909259 2:224443723-224443745 CAGAGGGAGGAGGATGGGGTAGG - Intergenic
948120486 2:235526234-235526256 GAGAGGCAGTTGGATCTGGATGG + Intronic
948347678 2:237312913-237312935 GAGAGGAAGAAGGAGGTGGGAGG - Intergenic
948860729 2:240751486-240751508 CAGGGGTATTAGGGTGTGGAGGG - Intronic
1171390076 20:24795574-24795596 CAGGGGAAGTTGGCTGTGGCTGG - Intergenic
1171777963 20:29388312-29388334 CAGAGCCAGTAGAATGTGGAGGG - Intergenic
1171819726 20:29823708-29823730 CAGAGCCAGTGGAATGTGGAGGG - Intergenic
1171898091 20:30829471-30829493 CAGAGACAGTGGAATGTGGAGGG + Intergenic
1172791767 20:37510774-37510796 GAGGGGAAGAAGGAGGTGGAGGG - Intronic
1172851718 20:37971156-37971178 AAGGGTAACTAGGATGTGGAAGG + Intergenic
1173167878 20:40698762-40698784 GGAAGGAAGGAGGATGTGGAAGG + Intergenic
1173465956 20:43281620-43281642 GAGGGGAAGTGGGATGGGGAAGG - Intergenic
1173474827 20:43351661-43351683 AAGAGGCTGAAGGATGTGGAAGG + Intergenic
1173817522 20:45999211-45999233 AAAAGGAGGTAGGAGGTGGATGG + Intergenic
1174179094 20:48663792-48663814 CAGGGGAAGGAGGATATGGCTGG - Intronic
1175390091 20:58621594-58621616 CAGAGGGAGTACGGTCTGGACGG + Intergenic
1175760572 20:61559993-61560015 CAGAATAAGTTGGATGTCGATGG - Intronic
1175913365 20:62414885-62414907 GAGAACAAGTAGGGTGTGGAGGG - Intronic
1177686944 21:24449322-24449344 GAGAAGAAGTAGAATTTGGAGGG - Intergenic
1178035476 21:28577817-28577839 TTGAGGAAGTAGGATTTAGAGGG - Intergenic
1178111049 21:29370504-29370526 CTAAGGAAGTAGCATGTGGAAGG + Intronic
1178305911 21:31489810-31489832 CAGATGAAGTGGGATGGGGAGGG - Intronic
1178982152 21:37273592-37273614 GGGAGAAAGTAGGATGGGGAGGG + Intergenic
1179180486 21:39040707-39040729 TATAGGAAGTAGGATATGGGTGG - Intergenic
1179246072 21:39635272-39635294 TAGAGGAAATAGGAGGTTGAGGG + Intronic
1179421472 21:41240111-41240133 CATAGGAAGCAGAATGTGGCTGG + Intronic
1179784328 21:43720871-43720893 CCAATGAAGTAGGAGGTGGATGG - Intronic
1180323728 22:11348399-11348421 CAGAGCCAGTGGAATGTGGAGGG - Intergenic
1180472905 22:15676972-15676994 CAGGGGAAGGAGGAGATGGAAGG - Intergenic
1180728893 22:17966419-17966441 CAGAGGAGTGAGGAGGTGGAGGG - Intronic
1181471959 22:23145975-23145997 CAGTGGAAGTAGAGTGGGGAGGG - Intronic
1182044545 22:27264100-27264122 CAGAGGAGACAGCATGTGGAAGG + Intergenic
1183135126 22:35879863-35879885 CAGAGCTAGTAGGATGGGCACGG + Intronic
1183245633 22:36691261-36691283 GAGACAAAGTAGGATGTGGCTGG + Intronic
1184159969 22:42692285-42692307 GAGAGGAAGAAGGATGGGGTGGG + Exonic
949465457 3:4339061-4339083 CTGAGGAAGTAGTTTGTGGAAGG - Intronic
949628125 3:5891088-5891110 CAGAGGAATTAGGATGAAGATGG - Intergenic
949809520 3:7991465-7991487 CAGTGGAAATAGGATCTGGAAGG - Intergenic
950141056 3:10615657-10615679 ATGAGCAAGTTGGATGTGGATGG - Intronic
950324974 3:12098416-12098438 CAAAGGATGTAGGGTGAGGAGGG + Intronic
950443851 3:13024862-13024884 AAGAGGAAGTAGCTTGTGTAGGG - Intronic
952277559 3:31892181-31892203 CAGAGGAAGGAGCACGTGTATGG + Intronic
952711347 3:36435241-36435263 CAGAGACAGTGGGAGGTGGAGGG - Intronic
953421091 3:42753872-42753894 CAAAGGAAGGAGGCTGTGGAAGG + Intronic
953459599 3:43072078-43072100 CAGAGAATGTAGAATTTGGAAGG + Intergenic
954052042 3:47987664-47987686 CAGAAGGAGTAGGATTTGAAGGG - Intronic
954526341 3:51275082-51275104 CACAGGAAGCAGGATGCGGCGGG - Exonic
954715088 3:52522951-52522973 CAGGGGAAGTAGGGTTTGGTCGG - Intronic
955761192 3:62284926-62284948 CAGAGGAAAGAGGATTTGCAGGG - Intronic
956106425 3:65823531-65823553 CAGGAGAAGCAGGCTGTGGAAGG - Intronic
956191220 3:66610280-66610302 CAGGGGCAGGAGGATGTGCATGG + Intergenic
956471060 3:69567245-69567267 CAGAGGAAGCAGCATAAGGAAGG - Intergenic
956543949 3:70378442-70378464 TATAGGAAGAAGGATGAGGAAGG + Intergenic
956569075 3:70673697-70673719 CAGATGGATTTGGATGTGGATGG - Intergenic
957087209 3:75692247-75692269 CAGAGCCAGTGGAATGTGGAGGG + Intergenic
957386704 3:79505302-79505324 AAGAGGAAGCAGGTTGAGGAAGG + Intronic
957413483 3:79870615-79870637 CAGAAGAATTTGGATGTGTATGG - Intergenic
958005080 3:87800240-87800262 CAGAGGAAGAAGGACTTGGAAGG - Intergenic
958893884 3:99809045-99809067 CTGAGGAAGAGGCATGTGGAGGG - Intergenic
958906602 3:99948621-99948643 GAGAGGAAGGAGGAGGAGGAGGG + Intronic
959693196 3:109221378-109221400 CAAAGGAAGCAGGATCAGGAGGG - Intergenic
959745930 3:109776643-109776665 TTGAGGAAGAAGTATGTGGATGG - Intergenic
960018915 3:112926961-112926983 TAGAAGAAGAAGTATGTGGAGGG + Intronic
960243295 3:115371142-115371164 GAGAGAAAGGAGAATGTGGAAGG - Intergenic
960390252 3:117069448-117069470 TACAGGAAGAAGGATATGGAAGG + Intronic
960623710 3:119660344-119660366 AGGTGGAAGCAGGATGTGGAAGG - Exonic
961012513 3:123446028-123446050 CAGAGGACGTTAGAAGTGGAAGG + Intronic
961077702 3:123997260-123997282 CAGAGGTAGCAGGAAGAGGAGGG - Intergenic
961306865 3:125964022-125964044 CAGAGGTAGCAGGAAGAGGAGGG + Intergenic
961411209 3:126721720-126721742 CAGGGTAAGTAGGATTTGGTGGG - Intronic
961595268 3:128011059-128011081 TAAAGGAAGTAGGAAGTGGGAGG - Intergenic
963748754 3:149152473-149152495 CAGTGGAGGTAGGAGGGGGAAGG + Intronic
963771750 3:149393296-149393318 CAGAGGAAGTAGCATGGGAAAGG - Intergenic
963938869 3:151081439-151081461 CAGGGGAAGTGGGAGGGGGAGGG - Intergenic
965353700 3:167647412-167647434 CAAAGGCAGCAGGATTTGGAAGG + Intronic
965801427 3:172497686-172497708 CAGAGGAGTTAGGTGGTGGAGGG + Intergenic
966473540 3:180319331-180319353 AAGGGGAAGTAAGATGAGGATGG - Intergenic
966532212 3:180993627-180993649 AAGAGCAAGCAGGAAGTGGAAGG + Intergenic
967012995 3:185456336-185456358 CAGAGGAAATAAGATGAGGTAGG + Intronic
967684027 3:192398874-192398896 CAGAGGAAGAAGGATTCTGAAGG - Intronic
968565773 4:1311953-1311975 GAGAGGAAGGAGGATGGTGAGGG - Intronic
968620037 4:1599918-1599940 GAGAGGAAATAGGAGGGGGAGGG - Intergenic
969104442 4:4794622-4794644 CAGAAGAAGCAGGATGGAGAGGG - Intergenic
969651214 4:8469378-8469400 CAGAGGAAGAAGGCTGAGGCTGG + Intronic
969996980 4:11323415-11323437 CAGAAGAAGTAGGAAGATGAAGG + Intergenic
970228639 4:13885858-13885880 CTGAGGCAATAGAATGTGGAAGG - Intergenic
970866937 4:20770092-20770114 CAGAAGAAGCAGGCTGTGGGAGG - Intronic
971041298 4:22755046-22755068 CAGAGGAAGAATGAGGTTGAAGG + Intergenic
971266615 4:25101507-25101529 AAGAGTAGGTAGGATTTGGATGG + Intergenic
971357985 4:25912259-25912281 GGGAAGAAGTAGGATGAGGATGG + Intronic
971530587 4:27683753-27683775 CAGAGGTAGTAAGAAGTGGCAGG - Intergenic
972374808 4:38460299-38460321 CAGAGGAAGAAGTAGGTGGCTGG - Intergenic
972806004 4:42529959-42529981 CTGGGGAAGAAGTATGTGGATGG + Intronic
972882882 4:43447548-43447570 TTGAGGAAGAAGTATGTGGATGG - Intergenic
973102999 4:46295371-46295393 TTGAGGAAGAAGTATGTGGATGG + Intronic
975095958 4:70456662-70456684 CAAAGGAGGTAGCTTGTGGAAGG - Intronic
975113865 4:70657602-70657624 CAGAGGAAGAAGTTTGTTGAAGG - Intronic
975969644 4:80017675-80017697 AATAGGAAGAAGGATGAGGAAGG + Intronic
977069178 4:92361620-92361642 CAGAGGAAGTAGGTTGTGATGGG + Intronic
977240073 4:94557448-94557470 CAGTGGTAGTTGGATGGGGATGG + Intronic
978005169 4:103606367-103606389 CAGTGGTAGTTGGATGGGGATGG + Intronic
979700244 4:123658744-123658766 CAGAGGGGGAAGGATGAGGAGGG + Intergenic
980191190 4:129527449-129527471 CAGAGGAAGGAGGATGGAGGTGG + Intergenic
980191478 4:129530344-129530366 CAGAGCATGTAGGATTTGCATGG - Intergenic
980213851 4:129825421-129825443 CTGAGGAGTTAGGATCTGGAGGG + Intergenic
981118521 4:141020676-141020698 CTGAGGAAGTAGGAATTGTATGG - Intronic
981432380 4:144676647-144676669 CACAGGACCTAGAATGTGGAAGG + Intronic
981703093 4:147628198-147628220 CAGTGGCAGAAGAATGTGGATGG - Intronic
981761807 4:148202779-148202801 CAGAGGAAGGGGGATGAGGGGGG - Intronic
982297874 4:153848546-153848568 CAGTGGAAGAAGGAGCTGGAGGG - Intergenic
982465159 4:155721460-155721482 CAGAGGAAGCAGAAAGTGGAAGG - Intronic
982935378 4:161468193-161468215 CAGAGGCAGTAGTATGTAGTGGG - Intronic
983137944 4:164107937-164107959 AAGAGGATGGAGGAGGTGGAGGG - Intronic
983971053 4:173874886-173874908 CAGAGGGAGTAGTATGTTCAAGG + Intergenic
984286769 4:177740260-177740282 CAGTGGAAGTGAGTTGTGGAAGG - Intronic
984551858 4:181170407-181170429 AATAGGAAGCAGCATGTGGAAGG + Intergenic
986221279 5:5770985-5771007 CAGAGGAAGTGGGTTGGGCAAGG + Intergenic
986865516 5:11981859-11981881 CAGAGAAAGTAGAATGTGGAAGG - Intergenic
986989107 5:13531201-13531223 AAGAAGAAGTAGGAAGGGGAGGG - Intergenic
987231319 5:15896595-15896617 CAGAGGAAGGAGGAACTGGCAGG - Intronic
987314484 5:16711455-16711477 GGGAGGAAGTAGCTTGTGGATGG - Intronic
988276655 5:29089664-29089686 AAGAGGAAGTAGAAAGAGGAGGG - Intergenic
988306314 5:29498781-29498803 CAGAAGTAGTGGGATGTGGTGGG + Intergenic
988322466 5:29716567-29716589 CAGAGGAAGCAGGATAGGAAAGG - Intergenic
988688381 5:33547966-33547988 CAGGGGAAGGAGGATGAAGAGGG + Intronic
989204013 5:38793713-38793735 CAGATGAAGAAGGATGGGTATGG - Intergenic
991690683 5:69222359-69222381 CAGAGGACGTAAGCTGTAGATGG + Intronic
992971390 5:82062609-82062631 AAGAAGAAGCAGGATGTGAATGG + Intronic
993104798 5:83587943-83587965 CTGAGAAAGTAGGATGAGAAGGG + Intergenic
993215415 5:85016592-85016614 CAGAGGAAGTATTATGTGACAGG - Intergenic
993272653 5:85815004-85815026 AAGGGGAAGTATGGTGTGGAGGG - Intergenic
995743904 5:115383687-115383709 CAGAGTAAGCAGTCTGTGGATGG + Intergenic
996812911 5:127540019-127540041 CAAAGGAAGTAGGATGTTCTGGG + Intronic
997060220 5:130492126-130492148 CAAAGAAAGTAGTATGAGGAGGG + Intergenic
997064381 5:130544727-130544749 CAGAGGAAGGAGGATGCCAAGGG + Intergenic
997630690 5:135366595-135366617 AAGAGCAAGTAGGATGGGGAGGG + Intronic
997696306 5:135863808-135863830 AGGAGGAAGGAGCATGTGGAGGG + Intronic
997863912 5:137444199-137444221 CAGAGGTAGAAGGATGTGTCAGG - Intronic
997897828 5:137735789-137735811 CAGAGGAAGGAGGATTGAGAAGG - Exonic
998165804 5:139842881-139842903 CAGAGGAAGGAGGAGGAGAAAGG - Exonic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998234162 5:140383497-140383519 AAAAGGAAGGAGGAAGTGGAGGG + Intergenic
998275940 5:140753531-140753553 CAGTGGAAGTATGATGGGGGAGG + Intergenic
999365754 5:151022357-151022379 CAGAGAGAATAGGATGGGGATGG + Intronic
999378789 5:151105460-151105482 CAGAGGAGGAAGCATGGGGAAGG - Intronic
999734972 5:154506225-154506247 CAGAGGCATTAGGGTGTGGGAGG + Intergenic
999833321 5:155341598-155341620 CAGAGAGAGAAGGATGAGGAAGG + Intergenic
1000024030 5:157343313-157343335 CACAGGAAGTAGAGAGTGGAAGG + Exonic
1000055499 5:157602577-157602599 CAGAAGAAGGGGGATGAGGAAGG + Intergenic
1000507177 5:162135785-162135807 AAGAGGAAGCAGGGTGAGGAAGG + Intronic
1001106592 5:168859806-168859828 GAGTGGGAGTAGGATGGGGAGGG + Intronic
1001633540 5:173194063-173194085 CAGATGAAGCACAATGTGGATGG - Intergenic
1002209050 5:177585099-177585121 CAGAGAAAGAAGGAGGAGGAAGG + Intergenic
1002745141 5:181464208-181464230 CAGAGGCTGTAGAATGTGCACGG - Intergenic
1003166989 6:3688341-3688363 GAGAGGAAGTGGGAGGTGGTGGG + Intergenic
1003203595 6:3987151-3987173 CATAGGAAGCAGGATGTAAATGG - Intergenic
1003389821 6:5703964-5703986 CAGAGGAAGGAGGAAGAGGGAGG - Intronic
1003595178 6:7468332-7468354 AACAGGAAGAAGGATGAGGATGG + Intergenic
1003936133 6:10976951-10976973 CACAGGAAGAAGGTTGGGGAAGG - Intronic
1004321578 6:14635458-14635480 CAAAGAAGGTAGGAGGTGGAAGG + Intergenic
1005064912 6:21808388-21808410 CCCAGGAAGAAGGATGTGGCGGG - Intergenic
1005665817 6:28053271-28053293 CTGAGGAACAAGGATGTGAAAGG - Intergenic
1008550872 6:52629259-52629281 CAGAGGTAGTGGGTTGGGGAAGG + Intergenic
1012652962 6:101780639-101780661 CAGAGGAAGAGAGAAGTGGAGGG - Intronic
1014159519 6:118151952-118151974 CAGAGGAAGTAGAAAATAGAGGG - Intronic
1014768254 6:125432217-125432239 CAAAGGAAGGAGGATGTGGGGGG - Intergenic
1015471633 6:133612785-133612807 CAGAGGAAGGAGCATGCAGAGGG - Intergenic
1016272207 6:142302028-142302050 CTGAGGAAGTAGGGTGTGCGTGG - Exonic
1016589409 6:145728320-145728342 CAGAGGAAGCAGGAGGATGAAGG + Intronic
1016914867 6:149235461-149235483 AAGAGGAACTAGGATCAGGAGGG + Intronic
1017347808 6:153405155-153405177 CAGACGAATCAGGTTGTGGATGG - Intergenic
1017369575 6:153689217-153689239 CAGAGGGAGAAGCATATGGAAGG + Intergenic
1017415828 6:154219573-154219595 CTGTGTAAGTGGGATGTGGAAGG - Intronic
1017491890 6:154952335-154952357 CAGGGGAAGAAGGATATGGAAGG - Intronic
1017830468 6:158123488-158123510 GAGAGGAAGGAATATGTGGAAGG + Intronic
1018525924 6:164710032-164710054 CAAAGGCAGGAGAATGTGGAAGG - Intergenic
1019250049 6:170737754-170737776 CAGAGGCTGTAGAATGTGCACGG - Intergenic
1019372663 7:671087-671109 CTGAGGAAGAAGGAGGTGGACGG - Intronic
1019860461 7:3653667-3653689 CAGAGGAACTGGGATTTGGAAGG + Intronic
1019949924 7:4363126-4363148 CAGAGTAAGGAAGATGAGGAAGG - Intergenic
1020119759 7:5496395-5496417 AAGAGGAAGAAGAATGTGGAAGG - Intronic
1020811643 7:12856224-12856246 CAAAAGAAGGAGGAAGTGGAGGG + Intergenic
1022717289 7:32910071-32910093 CTAAGGAAGTAGGAATTGGATGG - Intergenic
1023723080 7:43114552-43114574 CAGAGGAAGCAGCAAGCGGAGGG - Intronic
1023776155 7:43609736-43609758 CAGAGGAAATAGGGTTAGGAAGG + Intronic
1025003672 7:55339161-55339183 CAGAAGGAGTAGAATGAGGAAGG + Intergenic
1025828514 7:65030445-65030467 AAGAGGAAGAAGGAGGAGGAGGG + Intergenic
1026396479 7:69959601-69959623 CAGTGACAGTATGATGTGGAAGG - Intronic
1026484871 7:70809046-70809068 AAGAGGAAGTAAGATAGGGAGGG + Intergenic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1026831226 7:73611405-73611427 CAGAGGAAGTTGGCTGGGGCAGG - Intronic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1027724537 7:81787716-81787738 CAGAGCAAGTATGATTTGAAAGG + Intergenic
1028765552 7:94554057-94554079 CAGCGGAAGGAGGATTTTGAAGG + Intronic
1030503272 7:110386548-110386570 CAGGGGAAATAGGATGGAGAGGG + Intergenic
1031512726 7:122669707-122669729 CAGAGTATGTGTGATGTGGAAGG - Intronic
1031977609 7:128103940-128103962 CTGAGGATCTAGGACGTGGAAGG - Intergenic
1032012424 7:128355678-128355700 CAGAGGAAGTGGGTTGGGCAAGG - Intronic
1032534948 7:132655407-132655429 CAGAGAAAGAAGGGGGTGGAGGG - Intronic
1032536365 7:132668034-132668056 CAGAGGAGGTGGGGTGTGGTAGG - Intronic
1032962040 7:137046859-137046881 CAGAAGAAGGAGGAGGGGGAAGG + Intergenic
1033116797 7:138632621-138632643 CAGAGGAAGTAGGATGTGGAGGG + Intronic
1033391910 7:140936744-140936766 CACAGGGAGTAAAATGTGGATGG - Intergenic
1033449148 7:141447537-141447559 CAGAGCAAGCAGAATGCGGATGG - Intronic
1033605634 7:142926307-142926329 TACAGGCAGTAGGATGTGGCAGG + Intronic
1033796710 7:144853906-144853928 CAGAGTGAGTAGTGTGTGGAAGG - Intergenic
1033970658 7:147034872-147034894 CACAGGATGAAGGGTGTGGAGGG + Intronic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034336114 7:150324621-150324643 CAGAGAAAGTAGGATGGGTCTGG - Intronic
1034892345 7:154852399-154852421 AAGAGGAAGTGGGAAGTGGGTGG - Intronic
1035275272 7:157744695-157744717 CAGAAGACGGAGGATGTGGAAGG + Intronic
1035530351 8:346041-346063 CAGAGCCAATGGGATGTGGAGGG - Intergenic
1036217824 8:6895598-6895620 CAGAAGATGTAGGACTTGGAGGG - Intergenic
1036295957 8:7537433-7537455 CAGAGGAAGGAGTATGTGGCCGG + Intergenic
1036326609 8:7783586-7783608 CAGAGGAAGGAGTATGTGGCCGG - Intergenic
1037569686 8:20147889-20147911 CAGAGGCAGAAGGATCAGGAGGG - Intronic
1037881312 8:22574803-22574825 CTGGGGAAGGAGGATGTGGGCGG - Exonic
1039473908 8:37829407-37829429 GAGAGCAGGTGGGATGTGGAAGG - Intronic
1039529901 8:38251414-38251436 CAAGGGAAGTAGGATGTCGATGG - Intronic
1039965380 8:42280253-42280275 CAGGGGAAGCAGGTTGTGGTGGG - Intronic
1041278823 8:56190935-56190957 CAGAGGAAATAGCACGTGCAAGG + Intronic
1041896204 8:62927122-62927144 CAGAGAAGCTGGGATGTGGAGGG - Intronic
1043830079 8:84978077-84978099 CAGAGTTAGAAGAATGTGGAAGG + Intergenic
1045420264 8:102007733-102007755 CAGAGGGAGGAGGAAGTAGAAGG - Intronic
1047312800 8:123706608-123706630 CAGAGGAACTTGCATGTGGGTGG - Intronic
1047347186 8:124039741-124039763 CAGAGGAGGGTGGATGTGGCTGG + Intronic
1047415817 8:124663661-124663683 CAGAGGAGGTGGGAGGAGGATGG - Intronic
1047432552 8:124805412-124805434 CAGAGGAAGCAGGAGAGGGAAGG + Intergenic
1047499369 8:125430120-125430142 GAGAGGGAGTAGGAGGTGGGGGG - Intergenic
1049278185 8:141730384-141730406 GAGAGGAAGGAGGAGGAGGAGGG - Intergenic
1049357146 8:142194552-142194574 CAGAGGAGGTTGGCGGTGGAGGG + Intergenic
1049813571 8:144587404-144587426 CAGAGGAAGGAAAATGTAGAGGG + Intronic
1050475935 9:6041080-6041102 GAGAAGAAGGAGGATGAGGAAGG - Intergenic
1051073549 9:13202916-13202938 TATAGGAAGAAGGATGTGGGAGG + Intronic
1051513349 9:17904543-17904565 GATTGGAAGTAGGCTGTGGAGGG - Intergenic
1051548535 9:18303902-18303924 CAGAGAAAGGAGGAAGTGAAAGG - Intergenic
1052495745 9:29221291-29221313 CAGAGGAAGAAGAATGAAGAAGG + Intergenic
1052615083 9:30828852-30828874 CAGAGGAAGGGTAATGTGGATGG + Intergenic
1052656661 9:31371844-31371866 TAGTGGAAGAAGAATGTGGATGG + Intergenic
1052680239 9:31682050-31682072 GATAGGAAGTGAGATGTGGAAGG - Intergenic
1052923496 9:33992587-33992609 GAGGGGCAGTAGGATGGGGAGGG - Intronic
1053472233 9:38355123-38355145 GAGAGGAAGAAGGAAGGGGAGGG + Intergenic
1053750661 9:41251267-41251289 CAGAGCCAGTGGAATGTGGAGGG + Intergenic
1054256172 9:62815610-62815632 CAGAGCCAGTGGAATGTGGAGGG + Intergenic
1054335132 9:63800004-63800026 CAGAGCCAGTGGAATGTGGAGGG - Intergenic
1056814617 9:89792264-89792286 CAGGGGTAGGAGGATTTGGATGG + Intergenic
1057696753 9:97328625-97328647 CAGAGGGAGCACGATGAGGAAGG - Intronic
1057940590 9:99279539-99279561 CAGAGGAGGAAGTATGTGTAAGG - Intergenic
1058040183 9:100294211-100294233 GAGAGGAAGACGGATGGGGAGGG + Intronic
1058579687 9:106441415-106441437 GAGAGGAAGTAGGAGGAGGAAGG + Intergenic
1059063999 9:111063504-111063526 CAGAGAAGGTTGGATGTGGTGGG + Intergenic
1059299158 9:113298728-113298750 CTGGGTGAGTAGGATGTGGAGGG - Exonic
1059427730 9:114231580-114231602 CAGAGGAAGAAGGAACTGGTGGG - Intronic
1059692101 9:116695595-116695617 CAGGAGAAGGAGGAAGTGGAGGG - Intronic
1059774342 9:117460692-117460714 CAGAGGAAGTGTGAGGAGGAGGG + Intergenic
1060148249 9:121269573-121269595 CAGAGGAGGAAGGATGGGGGTGG + Intronic
1060992687 9:127857803-127857825 CAGAGGAGGCAGGAGGAGGAGGG + Intergenic
1061042968 9:128150241-128150263 CAGGGGAAGTGGTATGTGGTAGG + Exonic
1061178710 9:129011906-129011928 CAGAGACAGCAGGAGGTGGAGGG + Intronic
1061374481 9:130215904-130215926 AAGAGGGAGCAGGATGTGGGAGG - Intronic
1061899681 9:133666509-133666531 GAGAGGAAGGAGGAGGAGGAGGG - Intronic
1062051075 9:134447420-134447442 CAGAGGGAGGAGGATGCGGCTGG + Intergenic
1203371400 Un_KI270442v1:308973-308995 CAGAGCCAGTGGAATGTGGAGGG - Intergenic
1203579611 Un_KI270745v1:30339-30361 CAGAGGCTGTAGAATGTGCACGG - Intergenic
1185729708 X:2451540-2451562 TAGGGGAAGAAGAATGTGGACGG + Intronic
1186584761 X:10861064-10861086 CAGAGGCAGCAGTATGAGGATGG - Intergenic
1186701583 X:12095897-12095919 CACAGGAAGCAGGATGGAGAGGG - Intergenic
1188765957 X:34090806-34090828 CAGTGTAAGTAGGAAGTGAAGGG + Intergenic
1188852034 X:35143930-35143952 CTGGGGAAGAAGCATGTGGATGG - Intergenic
1189283983 X:39839047-39839069 CAGTGGAAGTAGGGTTTGGAGGG - Intergenic
1189650366 X:43182712-43182734 CAAAGAAAGAAGGGTGTGGAGGG - Intergenic
1189891797 X:45610565-45610587 CAGGGGAAGGAGGGTGTGGGTGG + Intergenic
1190053499 X:47169288-47169310 TGGAGGAAGAAGGATGGGGAGGG - Intronic
1191177200 X:57516915-57516937 TAGTGGAAGGAGGGTGTGGATGG + Intergenic
1191872301 X:65758460-65758482 CAGAGGATGGGGAATGTGGATGG + Intergenic
1192291931 X:69806776-69806798 CAGAGGAAATGGCATGTGCAAGG + Intronic
1192418357 X:71005082-71005104 AAGAGGAAGAGGGATGGGGATGG - Intergenic
1194788001 X:98110552-98110574 CCGAGGAATTAGGATCTCGAAGG + Intergenic
1196117571 X:112014082-112014104 CAGTAGAAGTGGGATGGGGATGG + Intronic
1196569512 X:117249065-117249087 CAAGGGAAATAGGAGGTGGAGGG - Intergenic
1197597662 X:128485887-128485909 CAGAGGAATTAAGATGGGGAAGG - Intergenic
1198438685 X:136640880-136640902 TACAGGAACTAGCATGTGGAAGG - Intergenic
1199798544 X:151227226-151227248 CAGGGGAAGTCAGATGTGGTCGG - Intergenic
1201066944 Y:10106110-10106132 CAGAGCCAGTGGAATGTGGAGGG + Intergenic
1201486138 Y:14496469-14496491 AAGAGGAGGCAGGATGAGGAAGG - Intergenic
1201943748 Y:19487723-19487745 CAGAGGAAGTAAGAAATGGTGGG + Intergenic