ID: 1033119160

View in Genome Browser
Species Human (GRCh38)
Location 7:138651806-138651828
Sequence TTGTATCTGAGGGCATAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 591
Summary {0: 1, 1: 0, 2: 6, 3: 77, 4: 507}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033119160_1033119164 15 Left 1033119160 7:138651806-138651828 CCTTCCTATGCCCTCAGATACAA 0: 1
1: 0
2: 6
3: 77
4: 507
Right 1033119164 7:138651844-138651866 ATCAATTAGTAATCCTATAGTGG 0: 1
1: 0
2: 2
3: 14
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033119160 Original CRISPR TTGTATCTGAGGGCATAGGA AGG (reversed) Intronic
900592814 1:3467513-3467535 GTGACTCTGAGGGCACAGGAGGG - Intronic
902928269 1:19712139-19712161 TTGTGTCTCAGGGAATAGGAAGG + Intronic
903092328 1:20932587-20932609 TTGTATCTCAGGAAATAAGAAGG + Intronic
903151509 1:21413334-21413356 TTGAAGCTGAGGGCATATGTGGG - Intergenic
903881184 1:26510573-26510595 TTTTATCTCAGGGAATAGGGAGG - Intergenic
904665401 1:32116861-32116883 TTGTATCTCAGGGAATAGGGTGG + Intronic
907585470 1:55613086-55613108 TTGTATTTGCTGGCATTGGAAGG + Intergenic
907685077 1:56602702-56602724 TTGTGTCTCAGGGAATAGGGAGG - Intronic
908333255 1:63093049-63093071 TTGTGTCTTAGGGAATAGGGAGG + Intergenic
908464858 1:64383474-64383496 TTGTATCTTAGGTAATAGGGAGG - Intergenic
908591083 1:65634571-65634593 TTCTATCTGAATGCATTGGAAGG + Intronic
908869795 1:68596300-68596322 TTGTGTCTTTGGGAATAGGAAGG - Intergenic
909147277 1:71952035-71952057 TTGTATCTTGGGGAATAGAAAGG - Intronic
909322078 1:74302307-74302329 TTGTGTCTCAGGGAATAGGTAGG - Intronic
909844053 1:80368088-80368110 TTGTATCTCAGGAAATAGGGAGG - Intergenic
909964338 1:81889072-81889094 TTGTGTCTCAGGGAATAGGGAGG - Intronic
910151529 1:84153068-84153090 CTGTGTCTTAGGGAATAGGAAGG + Intronic
910163223 1:84296573-84296595 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
910755674 1:90687867-90687889 TTGTGTCTCAGGGAATAGGGCGG + Intergenic
910845168 1:91598348-91598370 TTGTGTCTCAGGGAATAGGAAGG + Intergenic
911503123 1:98713713-98713735 TTGTCTCTCAGGGAATACGAAGG + Intronic
911649640 1:100373230-100373252 TTGTGTCTCAGGGAATAGGGAGG + Intronic
911928931 1:103875147-103875169 TTGTATCTCAGGGAATAGGGAGG + Intergenic
911987313 1:104644206-104644228 CTGTGTCTCAGGGCATAGGGAGG - Intergenic
913679338 1:121173758-121173780 TTGTATCTTAGGAAATAGGGAGG - Intronic
914031169 1:143961407-143961429 TTGTATCTTAGGAAATAGGGAGG - Intronic
914158279 1:145106556-145106578 TTGTATCTTAGGAAATAGGGAGG + Intronic
914709731 1:150202131-150202153 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
914960520 1:152202296-152202318 TTGTATCTTAGGGAATAGATAGG + Intergenic
915389204 1:155525811-155525833 TGGTATCTGAGGGGGTGGGATGG - Intronic
915600022 1:156916494-156916516 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
916831895 1:168501784-168501806 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
917669456 1:177258892-177258914 TTGTGTCTCAGGGAATAGGGAGG - Intronic
918130697 1:181625967-181625989 TTGTGTCTCAGGGGATAGGGAGG + Intronic
918201219 1:182268866-182268888 TTGTGTCTGTGAGCATGGGAAGG - Intergenic
919085758 1:192918663-192918685 TTGTACCTGAGGGCAGAGCAGGG - Intergenic
919200087 1:194345070-194345092 TTGTGTCTCAGAGAATAGGAAGG + Intergenic
920466639 1:206192301-206192323 TTGTATCTTAGGAAATAGGGAGG - Intronic
921141889 1:212316055-212316077 TTGTGTCTCAGGGAATAGGGAGG - Intronic
921379524 1:214510098-214510120 TTGTGTCTCAGGGAATAGGGAGG + Intronic
921402621 1:214743019-214743041 TTGTGTCTCAGGTAATAGGAAGG + Intergenic
922046329 1:221949400-221949422 CTGGAGCTGAGGGCATAGTAAGG + Intergenic
922171574 1:223159916-223159938 TTGTACCTGAGTACCTAGGAGGG + Intergenic
922659148 1:227414056-227414078 TTGTATCTCATGGAATAGGGAGG + Intergenic
922903129 1:229153808-229153830 TTGTATCTCAGGGAATAGGGAGG + Intergenic
923355378 1:233149964-233149986 TTAGATCTGAGGGGAAAGGAAGG - Intronic
923717832 1:236440869-236440891 TTGTGTCTCAGGGAATAGGAAGG - Intronic
923898282 1:238297036-238297058 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1063329470 10:5142588-5142610 TTATGTCTTAGGGTATAGGAAGG + Intergenic
1063802110 10:9591947-9591969 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1063819711 10:9820080-9820102 TTGTCTCTCAGGGCAGGGGAAGG - Intergenic
1065543491 10:26794559-26794581 AGGAAACTGAGGGCATAGGATGG - Intronic
1065687297 10:28299330-28299352 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1065699969 10:28415362-28415384 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1066374681 10:34846942-34846964 TTGTGTCTTAGAGAATAGGAAGG - Intergenic
1068748711 10:60566252-60566274 TTGTATCTCAGGGAATAGGGAGG - Intronic
1068811289 10:61258407-61258429 TTGTAGCTCAGCTCATAGGAAGG - Intergenic
1069875532 10:71560654-71560676 ATGCAACTGAGGGCAGAGGATGG + Intronic
1070144930 10:73766902-73766924 TTGTATCCCAGGGGATAAGATGG - Intronic
1070520749 10:77250984-77251006 TTGAGTCTGCTGGCATAGGAGGG - Intronic
1070944792 10:80380974-80380996 TTGTGTCTTGGGGAATAGGAAGG + Intergenic
1071851648 10:89577718-89577740 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1071871833 10:89804005-89804027 ATGTATCTCAGGGAATAGGGAGG + Intergenic
1072746737 10:97945235-97945257 TTGGATCTGAGGATATGGGAAGG + Intronic
1074259906 10:111841973-111841995 GTGAATCTGAAGGCCTAGGATGG - Intergenic
1074259962 10:111842549-111842571 ATGAATCTGAAGGCCTAGGATGG + Intergenic
1075179509 10:120197229-120197251 TTGTGTCTCAGGGAATAGGTAGG + Intergenic
1075186143 10:120259707-120259729 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1075490740 10:122866782-122866804 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1076205928 10:128602784-128602806 CTGTGTCTCAGGGCATAGGGAGG - Intergenic
1078117717 11:8470710-8470732 TTGTCTCTCAGGGACTAGGAAGG + Intronic
1078398940 11:11007035-11007057 TTGTGTTTTAGGGAATAGGAAGG + Intergenic
1078963829 11:16313284-16313306 TTGTAGATGAGGGCAAATGAGGG + Intronic
1079151535 11:17904152-17904174 TTGTATCAGAGGGCTAATGAGGG + Intronic
1079357757 11:19743973-19743995 CTGTATCTGAGGCCAGTGGAGGG - Intronic
1079433187 11:20416946-20416968 TTGTCTCTGAGGGGAAAGGGTGG + Intronic
1079832436 11:25285223-25285245 TTGTTTCTCAGGGAATAGGAAGG + Intergenic
1080171071 11:29303607-29303629 TTGTGTCTCAGGGAATAGGAAGG - Intergenic
1082971667 11:59029310-59029332 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1084668172 11:70588150-70588172 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1084738878 11:71125125-71125147 TTGTGTCTCGGGGCATAGGGAGG - Intronic
1084859051 11:72006328-72006350 TGGGATCTGAGGGCTTCGGAAGG - Intronic
1085616777 11:78006298-78006320 TTGTATCTCAAGGAATAGGGAGG - Intergenic
1085734712 11:79029442-79029464 TTGTGTCTGAGGGCAGTGTATGG + Intronic
1086734251 11:90286046-90286068 TTGTATCTTAGGGAATAGGGAGG + Intergenic
1087665711 11:101045027-101045049 TTGTATCTCAGGGAACAGGGAGG + Intronic
1087966105 11:104417990-104418012 TTGTGTCTCAGGGAATTGGAAGG + Intergenic
1088567881 11:111192154-111192176 TTATATCTCAGGGAATAGGAAGG - Intergenic
1089410049 11:118233373-118233395 CTGCCTCTGAGGGCATAGGATGG + Intronic
1090557097 11:127887997-127888019 TTTTGTCTCAGGGAATAGGAGGG + Intergenic
1092137580 12:6160412-6160434 TGGTCTCTGTGGGCTTAGGAGGG - Intergenic
1092565678 12:9662753-9662775 ATGTATCTGAGAGCACTGGAAGG - Intergenic
1093617178 12:21240444-21240466 TTCTGTCTCAGGACATAGGAAGG + Intergenic
1094205357 12:27833904-27833926 TTGTATCTCAAGGAATAGGGAGG - Intergenic
1094303946 12:28996914-28996936 TTGTGTCAGACGACATAGGAGGG + Intergenic
1094632644 12:32191889-32191911 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1095308405 12:40664726-40664748 TTGTATCTCAGGGAATTGGGAGG - Intergenic
1095546937 12:43383446-43383468 TTGAATATGAGGGCAGATGATGG - Intronic
1095730893 12:45505846-45505868 TTGTATGTCAGGGAATGGGAAGG - Intergenic
1095881778 12:47144841-47144863 TTATGTCTCAGGGAATAGGAAGG - Intronic
1095922896 12:47548602-47548624 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1096434875 12:51581096-51581118 TTGTATCTTAGGGAATAGAGAGG - Intergenic
1096793163 12:54057827-54057849 ATGTATGTGAGGGAAGAGGAAGG - Intergenic
1096913873 12:55011405-55011427 TTGTAGCTGAGAGAATAGGAGGG + Intergenic
1097123663 12:56755540-56755562 TTGTGTCTTAGGGAATAGGGAGG + Intronic
1097758465 12:63433861-63433883 TTGTATCTCAGGGAATAGAGAGG - Intergenic
1097788599 12:63789232-63789254 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1098075194 12:66722327-66722349 TTGTGTCTCAGGGAATAGGAAGG + Intronic
1098091329 12:66905014-66905036 TTGTATCTAAGGACTTGGGATGG - Intergenic
1098744234 12:74215428-74215450 TTGTGTCTCAGGGAATAGCAAGG + Intergenic
1098800722 12:74953878-74953900 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1098818936 12:75206811-75206833 TTGAATCTGAGGACAGAGGAAGG - Intronic
1099003527 12:77209657-77209679 TTGTGTCCCAGGGAATAGGAAGG + Intergenic
1099503113 12:83438005-83438027 TTGTAACTCAGGGAATAGGGAGG + Intergenic
1100516435 12:95332754-95332776 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1100791193 12:98132019-98132041 TTGTGTCTCAGGGACTAGGAAGG + Intergenic
1100961919 12:99972137-99972159 TTGTATCCGAGGGAATAGGGAGG - Intronic
1102952553 12:117040337-117040359 TGGTCGCTGAGGGCATTGGAAGG + Intronic
1104488466 12:129172893-129172915 TTGTGTCTCAGGGAATAGGCAGG + Intronic
1104807739 12:131600173-131600195 TTGGATCTCAGGCCAAAGGAAGG - Intergenic
1105780065 13:23697787-23697809 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1105868237 13:24480314-24480336 TTGTATCTCAGGGAATAGGGAGG - Intronic
1106456580 13:29933125-29933147 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1106915486 13:34509346-34509368 TTGTGTCTCAAGGAATAGGAAGG + Intergenic
1106941229 13:34782078-34782100 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1106946663 13:34835320-34835342 TTGTATCTCAGGGAAGAGGGGGG - Intergenic
1107064076 13:36193702-36193724 TTGTATTTCAGGGCATGGAATGG - Exonic
1107706405 13:43110992-43111014 TGCAATCTGAGGGCCTAGGAAGG + Exonic
1108094000 13:46881195-46881217 TTGCATCTGTGGGCAGAGGAGGG + Intronic
1108331142 13:49385692-49385714 TTGTATCTTAGGGAACAGGGAGG + Intronic
1109001512 13:56811395-56811417 TTGTATCTCAGGCGATAGGTGGG - Intergenic
1109131278 13:58589266-58589288 TTGTGTCTCAGGAAATAGGATGG - Intergenic
1109350478 13:61174191-61174213 TTGTGTCTCAGGGAATAGGAAGG - Intergenic
1109623801 13:64947150-64947172 TTGTATGTGGGGGAATTGGATGG - Intergenic
1110378996 13:74827933-74827955 TTGTGTCTCAGGGAATAGGAAGG - Intergenic
1110400699 13:75088083-75088105 TAGCATCTGAGGGCAGAGAAGGG - Intergenic
1112623076 13:101071943-101071965 TTGTGTCTCAGGACATAGGGAGG + Intronic
1112850310 13:103698079-103698101 TTTTATCTGAAGGCAAAAGAGGG - Intergenic
1112856693 13:103779541-103779563 TTGTATCTCAGGGAATAGGGAGG + Intergenic
1113196830 13:107818110-107818132 TGGTATATGATGGCATCGGAGGG + Intronic
1114734287 14:25027566-25027588 TTGTGTCTTAGGGAATAGGGAGG - Intronic
1115060609 14:29184730-29184752 TTGTTTCTCAGGAAATAGGAAGG + Intergenic
1115149884 14:30272174-30272196 TTGTTTCTGAAGGCACAGAAGGG + Intergenic
1115195567 14:30795192-30795214 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1115379146 14:32714071-32714093 TTGTGTCTCAAGGAATAGGAAGG + Intronic
1115486806 14:33918317-33918339 TTGTGTCTTAGGGAATAGGGAGG - Intergenic
1116144253 14:41043339-41043361 TTGTGTCTCAGGGAATAGGAAGG + Intergenic
1116476192 14:45342598-45342620 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1116526330 14:45910404-45910426 GGGTATCTGTGGGCACAGGATGG - Intergenic
1116562147 14:46394013-46394035 TTGTATCTCACGGAATAGGGAGG - Intergenic
1116604889 14:46979310-46979332 TTGTGTCTCAGGGAAGAGGAAGG - Intronic
1116828778 14:49697254-49697276 TTGTATCTGAGGGAATAAGGAGG + Intronic
1117269583 14:54128505-54128527 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1118045254 14:61963121-61963143 TTGTGTCTCAAGGAATAGGAAGG - Intergenic
1118507724 14:66432466-66432488 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1118662612 14:68030898-68030920 TTGTGTCTCAAGGAATAGGAAGG + Intronic
1118959913 14:70519656-70519678 TTATATCTTAGGGAATAGGGAGG - Intergenic
1119964239 14:78895795-78895817 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1120264696 14:82234017-82234039 CTGTATCTCAGGGAATAGGGAGG - Intergenic
1124093337 15:26626308-26626330 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1124461024 15:29891823-29891845 TTGTATCTCAGGGAATAAGGAGG - Intronic
1124639268 15:31385732-31385754 TTGTGTCTTAGGGAATAGGGAGG - Intronic
1124670783 15:31636475-31636497 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1124901593 15:33828262-33828284 TTATGTCTCAGGGAATAGGAAGG - Intronic
1125236746 15:37523656-37523678 TTGTGTCTTAGGGTATAGGGAGG + Intergenic
1125545947 15:40505145-40505167 CTGTAGGTGAGGGCATAGGAGGG + Intergenic
1125822748 15:42646920-42646942 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1125981365 15:44004675-44004697 TTGTGTCTCAGGGTATAGGGAGG - Intronic
1126061385 15:44785866-44785888 TTGTCTCTGAGGGGATTGAAGGG - Intergenic
1127038976 15:54952396-54952418 TTATAACTGAGGCCATTGGAAGG + Intergenic
1127370657 15:58335997-58336019 TTGTGTCTTAGGAAATAGGAAGG - Intronic
1127447123 15:59074932-59074954 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1127661086 15:61100736-61100758 TTGTAACTGAGGGCATGTGCTGG - Intronic
1128786571 15:70401904-70401926 TTGTTTTTGAGGACAAAGGAAGG - Intergenic
1131169671 15:90168655-90168677 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1132076873 15:98828966-98828988 TTGTAACTGAGTGCTTCGGAGGG - Intronic
1133775467 16:8891789-8891811 TTGTGTGTGAGGGCGTGGGAAGG + Intergenic
1135165757 16:20137824-20137846 ATATATCAGAGGGCAGAGGAGGG - Intergenic
1135505243 16:23030810-23030832 TTGTATCTGATGGCAACAGAGGG - Intergenic
1135506652 16:23043367-23043389 TTGTGTCTCGGGGAATAGGAAGG + Intergenic
1135917048 16:26614591-26614613 TTGCATCTGAGGGCAACGGCAGG + Intergenic
1136987314 16:35119897-35119919 GTGTTTTTGAAGGCATAGGAGGG - Intergenic
1140162623 16:72513769-72513791 TTGTATCTTAGGGAATAGGGAGG + Intergenic
1140574670 16:76152695-76152717 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1142213247 16:88818310-88818332 GTGAGTCTGAGGGCAGAGGATGG - Intronic
1142410057 16:89911422-89911444 TCGAATCCGAGGGCATGGGACGG - Intergenic
1142616244 17:1137434-1137456 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1144030959 17:11323057-11323079 TTGGTCCTGTGGGCATAGGATGG - Intronic
1148660276 17:49325273-49325295 TTGTATCTCAGGGAATAGGAAGG + Intronic
1149378099 17:56065621-56065643 TTGTGTCTCAGGGAATAAGAAGG + Intergenic
1150638195 17:66931271-66931293 TTCTACCTGGGGGCAAAGGACGG + Intergenic
1150833948 17:68548028-68548050 TTGTGTCTTAGGGAATAGGGAGG + Intronic
1151793024 17:76321613-76321635 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1153126520 18:1798533-1798555 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1153292795 18:3518196-3518218 TTGTGACTCAAGGCATAGGAAGG + Intronic
1153977080 18:10278761-10278783 TTGTGTCTTAGGGAATAGGGAGG + Intergenic
1154127811 18:11708305-11708327 TTATGTCTCAGGGCATAGGGAGG + Intronic
1154249502 18:12731785-12731807 TTGTATCTCAGGAAATAGGGAGG + Intergenic
1155101601 18:22615865-22615887 TTCTGTCTGAGGGAATAGGGAGG - Intergenic
1155137623 18:23011876-23011898 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1157371842 18:47120799-47120821 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1158582111 18:58692507-58692529 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1158978151 18:62731512-62731534 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1159121201 18:64173544-64173566 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1159180594 18:64897766-64897788 TTGTGTCTTAGGGAATAGGAGGG + Intergenic
1159198856 18:65156857-65156879 TTGTGTCTCAGGGGATAGGAAGG - Intergenic
1160520289 18:79504367-79504389 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1161559757 19:4966126-4966148 TTGCATCTGACTGCAAAGGATGG + Intergenic
1164940160 19:32246006-32246028 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1165125017 19:33588250-33588272 TTGTGTCTCAGGACATAGGGAGG - Intergenic
1165913432 19:39243902-39243924 CTGGATCTGTGGGCAGAGGAGGG + Exonic
1165917523 19:39269721-39269743 CTGGATCTGTGGGCAGAGGAGGG - Exonic
1166956151 19:46466171-46466193 TTCTGTGTGAGGGAATAGGAAGG + Intergenic
1167489173 19:49781931-49781953 TTGTCTCCTAGGGCAGAGGAAGG - Exonic
1167647453 19:50713431-50713453 CTCTATCTGGGGGCATAGCAGGG + Intronic
1168181129 19:54663700-54663722 TGGGATCTGAGGGCTGAGGAAGG + Intronic
1168243779 19:55099792-55099814 TTCAATCTGAGGGCAAAGGCAGG + Intronic
925200462 2:1964133-1964155 TTGTGTCTCAGGGAATAGGAAGG + Intronic
925507919 2:4589665-4589687 TTTTATCTAAGGTTATAGGAAGG - Intergenic
926387968 2:12356597-12356619 TTGTATCTCAGGGAATAGGGAGG + Intergenic
926413496 2:12628102-12628124 TTGTGACTGAGGGGACAGGAAGG - Intergenic
926449983 2:12991237-12991259 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
926836292 2:17025605-17025627 TTGTGTCTTAGGGAATGGGAAGG + Intergenic
927755324 2:25703942-25703964 TTGTATGTCAGGGAATAGGGAGG - Intergenic
928657240 2:33464924-33464946 TTGTGTCTCAGGGAATAGGAAGG - Intronic
929338156 2:40777678-40777700 TTGTATCTCAGGAAATAGGGAGG + Intergenic
929511170 2:42567658-42567680 TTGTATCTGTGAGAGTAGGAAGG + Intronic
929939161 2:46318136-46318158 TTGTGTCTCAGGGAATAGGAAGG + Intronic
930919415 2:56734046-56734068 TTGTATCTCAGGGAATAAGGAGG - Intergenic
930991812 2:57665247-57665269 TTGCATCTCAGGGAATAGGGAGG + Intergenic
931895270 2:66721782-66721804 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
931924843 2:67060866-67060888 TTGTGTCTCAGGGTATAGGGAGG + Intergenic
932286462 2:70537275-70537297 TTGTGTCTCAGGGAATAGGGAGG - Intronic
933896822 2:86818677-86818699 TTGTGGCTCAGGGCATAGGGGGG - Intronic
934061658 2:88299868-88299890 TTGTGTCTTAGGGAACAGGAAGG - Intergenic
935013524 2:99157803-99157825 TGGTAACTGAGGCCACAGGAAGG - Intronic
935344136 2:102089297-102089319 TTGCATCTCAGAGAATAGGAAGG + Intronic
935974290 2:108562196-108562218 TTGTGTCTCAGGGAATAGGGAGG - Intronic
937381728 2:121383420-121383442 TTGGAGGTGAGGGCATAGGAGGG + Intronic
937818096 2:126275766-126275788 ATGGATCTGAGGTCATAGAAAGG - Intergenic
937818537 2:126281039-126281061 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
938593408 2:132762370-132762392 TTGTAACTTATGGCATAGTAAGG - Intronic
938681947 2:133701169-133701191 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
938960625 2:136337431-136337453 TTGTTTCTGAGGAAATAGGAAGG - Intergenic
941056438 2:160794980-160795002 TTGTACCTCAGGGAATAGGGGGG - Intergenic
941077481 2:161022278-161022300 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
941079161 2:161040480-161040502 GTGTTTCTGAGGCCAGAGGATGG - Intergenic
941697290 2:168566736-168566758 TTTTATCTGAGGAAATAGTATGG + Intronic
942507768 2:176661570-176661592 TTGTATCTCAGGGAATAGGGAGG - Intergenic
943034493 2:182725243-182725265 TTGTATCTCAGGGAGTAGGGAGG - Intronic
943123430 2:183766664-183766686 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
943292833 2:186097049-186097071 TTGTGTCTCAGGGAATAGGGTGG - Intergenic
944338106 2:198562093-198562115 TTGTGTCTCAGGGAATAGGGAGG - Intronic
944529578 2:200654023-200654045 TTGTGTCTCAGGGAATAGGGAGG - Intronic
945575107 2:211521006-211521028 CTGTATGTCAGGGGATAGGAAGG - Intronic
945894825 2:215470063-215470085 TTGTGTCTCAGGGAATGGGAAGG + Intergenic
946645452 2:221828572-221828594 TTGTGTCTCAGGGAGTAGGAAGG + Intergenic
946713612 2:222531128-222531150 TTGTGTCTCAGAGCATAGGGAGG + Intronic
947754175 2:232549917-232549939 TTGTGTCTCAGGGAATAGGGAGG + Exonic
948107149 2:235423719-235423741 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1169090244 20:2856167-2856189 GTGTGTCTCAGGGAATAGGAAGG + Intronic
1169160554 20:3374075-3374097 TTGCACTTGAGGGCATTGGAGGG - Exonic
1169466196 20:5842250-5842272 TTTTATCTGAAGGTAGAGGAAGG - Intronic
1169485201 20:6024519-6024541 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1170247063 20:14233000-14233022 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1170364143 20:15581694-15581716 GTGTATTTGAGGTCACAGGAGGG + Intronic
1173910728 20:46668071-46668093 TTGTATCTCAGGGAATAGGGAGG - Intronic
1174650538 20:52121127-52121149 TTGTGTCTCAGGGAATAGAAAGG - Intronic
1175168014 20:57059845-57059867 TTGCATCTCAGGGAATAGGGAGG + Intergenic
1176220888 20:63968994-63969016 TTGGATCCGAGGGGATGGGAAGG + Intronic
1176735853 21:10546372-10546394 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1176960018 21:15148717-15148739 TTGTAGCTGAGGGCATACTCAGG + Intergenic
1177162504 21:17563383-17563405 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1177860870 21:26452343-26452365 CTGTATCTTAGGAAATAGGATGG + Intergenic
1179141909 21:38733191-38733213 GTATAGCTGAGGGTATAGGATGG + Intergenic
1179202784 21:39241984-39242006 TTGTATCTCAGGGAATAGACTGG - Intronic
1180113284 21:45676660-45676682 TTGTGTCTCAGGGCATACGGAGG - Intronic
1180878960 22:19190283-19190305 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1180932578 22:19603196-19603218 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1183533298 22:38376498-38376520 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1183757886 22:39787282-39787304 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1185096939 22:48814027-48814049 TTGCGTCTCAGGGAATAGGAAGG - Intronic
949438360 3:4053169-4053191 TTGTGTCTCAGGGAATAGGGAGG + Intronic
950112668 3:10429612-10429634 TTGTGTCTCAGGGAATAGGGAGG - Intronic
950562118 3:13737426-13737448 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
950817881 3:15726115-15726137 TTGTGTCTGAGTGAAGAGGAAGG - Intronic
951042954 3:18008420-18008442 TTGTGTCTCAGGGAATAGGGAGG + Intronic
951176337 3:19605183-19605205 TTATGTCTCAGGGAATAGGAAGG + Intergenic
951306631 3:21071142-21071164 TTGTATCTCAGGAAATAGGGAGG - Intergenic
951307219 3:21079683-21079705 TTGTATTTCAGGGAATAGGGAGG + Intergenic
951347355 3:21561647-21561669 TTGTGTCTCAGGAAATAGGAAGG + Intronic
951851800 3:27149681-27149703 TTGTGTCTCAGGGAATAGGAAGG - Intronic
952010472 3:28895072-28895094 TTGTAAGTGAGGGCATAGATTGG - Intergenic
952365494 3:32671274-32671296 CTGTGTCTCAGGGGATAGGAAGG + Intergenic
955349556 3:58183670-58183692 TTGGTTATGAGGTCATAGGAGGG + Intergenic
955416608 3:58697846-58697868 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
955831009 3:63004082-63004104 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
956017600 3:64900267-64900289 TTGAATCCCAGGGCTTAGGATGG - Intergenic
956395207 3:68818640-68818662 TTGTGTCTCAGGGAATAGGAAGG + Intronic
956506700 3:69948205-69948227 CTGTATTTCAGGGCATGGGAAGG + Intronic
957126308 3:76165763-76165785 TTGTATCTCAGAGAATAGGAAGG + Intronic
957155225 3:76536895-76536917 CTGGAGCTGAGGGCATAGTAAGG - Intronic
957334877 3:78815121-78815143 TTGTGTCTCAGGGAATAGGAAGG - Intronic
957832289 3:85538195-85538217 TTGTGTCTCATGGCATTGGAAGG - Intronic
958435836 3:94094799-94094821 TTGTTTTTGGGGGCTTAGGATGG - Intronic
958494481 3:94826842-94826864 TTGTGTCTCAGGGAATAGTAGGG + Intergenic
958507137 3:94994162-94994184 TTTTATTTGAGGGCATAACATGG - Intergenic
958530077 3:95317009-95317031 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
958718295 3:97814070-97814092 TTGTGTCTCAGGGAATAGGAAGG + Intergenic
959109788 3:102108603-102108625 TTGTATCTTAGGGTATAGGGAGG + Intronic
959562714 3:107800830-107800852 TTTTATCTGAGGTCAAAGAATGG - Intronic
959773090 3:110123423-110123445 TTTTATCTTAGGGAATAGGGAGG - Intergenic
960540527 3:118856785-118856807 TTTTGTCTCAGGGAATAGGAAGG - Intergenic
960648078 3:119912164-119912186 TTGTCTCTCAGGGAATAGGGAGG + Intronic
960863265 3:122174134-122174156 TTGTGTCTCAGGGAATAAGAAGG + Intergenic
961411609 3:126726224-126726246 TTGTGTCTCAGGGGATAGAAAGG + Intronic
961613154 3:128156813-128156835 TTGTGTCTCAGGGAATAGGGAGG - Intronic
961733182 3:128982753-128982775 GTGTATCTCAGGGAATAGGGAGG + Intronic
962033485 3:131626122-131626144 TTGTATCTAAGGAAACAGGAAGG - Intronic
962173862 3:133131628-133131650 TTGTGTCTCAGGGAATAGGGAGG - Intronic
963584498 3:147167453-147167475 TTGTTTCTCAGAGCATAGGGAGG + Intergenic
963608793 3:147439265-147439287 TTGTATCTCTGGGAATAGGGTGG + Intronic
963908593 3:150795269-150795291 TTTAATCTGAGGTCATGGGATGG - Intergenic
964019125 3:151985601-151985623 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
964124236 3:153219262-153219284 TTATACTTGAGGGCAGAGGAGGG - Intergenic
964146627 3:153471826-153471848 TTGTGTCTTAGGGAATAGGGAGG + Intergenic
964398818 3:156277106-156277128 TTGTATCTCAGGGAATAGAAAGG + Intronic
964795596 3:160493368-160493390 AGGGGTCTGAGGGCATAGGAAGG + Intergenic
964823299 3:160797389-160797411 TTGTGTCTCAGGGAATAGGGAGG - Intronic
965458963 3:168937580-168937602 TTGTGTCTCAGGGCATAGAGAGG + Intergenic
965886695 3:173454956-173454978 TTGTGTCTTAGGGAATAGGGAGG + Intronic
966214322 3:177486385-177486407 TTGTGTCTGAGGGAATAGGGAGG + Intergenic
966644720 3:182231645-182231667 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
967034808 3:185640340-185640362 TTGTTTCTTAGAGAATAGGAAGG - Intergenic
968244532 3:197129756-197129778 TTGTATCTTGGGGAATAGGGAGG + Intronic
970945198 4:21682736-21682758 TTGTATCTCAGGAAATAGGGAGG + Intronic
971547302 4:27902571-27902593 TTTTATCTGAGGTAACAGGAAGG - Intergenic
971709055 4:30087969-30087991 TTGTGTCTTATGGAATAGGAAGG + Intergenic
971921298 4:32943076-32943098 TTGTGTCTCAGGGAATAGGAAGG - Intergenic
972221095 4:36955573-36955595 TTATAGCTGAGGGCAAAGGCTGG - Intergenic
972383707 4:38543316-38543338 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
972682484 4:41319883-41319905 TTGTATCTGAGAGTATACGAGGG + Intergenic
973235284 4:47895978-47896000 TTGTCTCTCAGGGAATAGGAAGG + Intronic
973278333 4:48333545-48333567 TTTTACCTGAGGGCATATTAGGG - Intergenic
973573841 4:52266225-52266247 CTGTGTCTGAGGGCAAAGCAGGG - Intergenic
974613341 4:64246074-64246096 TTGTCTCTTAGGGAATAGGGAGG + Intergenic
975092018 4:70415136-70415158 TTGTTTCTTAGGGAATAGGGTGG + Intergenic
975124908 4:70770936-70770958 TTGTGTCTTAGGGAATAGGGAGG + Intronic
975323012 4:73029343-73029365 TTGTGTCTCAGAGAATAGGAAGG - Intergenic
975686546 4:76921491-76921513 TTGTATCTCAGGGAATAGGGAGG + Intergenic
976468503 4:85399386-85399408 TTGTGTCTGAGGGAATAGGAAGG - Intergenic
976835314 4:89365846-89365868 TTATGTCTCAGGGAATAGGAAGG - Intergenic
976934616 4:90614287-90614309 TTGTGTCTTAGGGAATAGGGAGG - Intronic
977314343 4:95426379-95426401 TTGTGTCTTAGGGAATAGGAAGG - Intronic
977597063 4:98894967-98894989 TTGTGTCTCAGGGAATAGGCAGG + Intronic
977987541 4:103401507-103401529 TTATCTCTGAGGGCAAAGAAAGG - Intergenic
978016116 4:103748690-103748712 TTGTATCTAACGACAAAGGAAGG - Intergenic
978872587 4:113597879-113597901 TTGTGTCTCAGGGAATAGGAAGG + Intronic
979123695 4:116937694-116937716 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
979307732 4:119166957-119166979 TTGTGTCTCAGGGAATAGGGAGG - Intronic
979345631 4:119583687-119583709 TTGTCTCTCAGGGAATAGGGAGG + Intronic
979448834 4:120844642-120844664 TTGTGTCTCAGGGAATAGGGAGG - Intronic
979659073 4:123231800-123231822 TTGTGTCTCAGGGCATAGGAAGG + Intronic
979729447 4:124006369-124006391 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
979744467 4:124194038-124194060 TTGTGTCTTAGGGAATAGGGAGG + Intergenic
980540886 4:134193325-134193347 TTGTATTTTAGGATATAGGATGG - Intergenic
980635687 4:135498913-135498935 TTGTATCTCTGGGAATAGGAAGG + Intergenic
981628675 4:146791542-146791564 TTGTGTCTCAGGGAATAGGGAGG - Intronic
981683445 4:147426555-147426577 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
982404127 4:155001819-155001841 TAGTACATGAGGGCAAAGGAGGG - Intergenic
982552377 4:156818900-156818922 TTGTATCTCAGGGAATAAGGAGG + Intronic
982575705 4:157107187-157107209 TTGTATCTCAGAGCATAAGAAGG - Intronic
982681697 4:158438795-158438817 TTGTGTCTTAGGGAATAGGGAGG - Intronic
982946086 4:161625564-161625586 TTGTGTCTTAGGGAATAGGGAGG - Intronic
982975019 4:162045256-162045278 TTGCATCTCAGGGAATAGGGAGG + Intronic
983395924 4:167195494-167195516 CTGCATCTGAGGGCATAGACAGG + Intronic
983547283 4:168977459-168977481 TTCTATGTGTGGGCATAGGATGG - Intronic
983658486 4:170107570-170107592 TTGCATCTCAGGGAATAGGGAGG + Intergenic
983701994 4:170608409-170608431 TTGTATCTCAGGGAATAGGGAGG + Intergenic
985481743 5:116171-116193 TTGTGTCTTAGGGAATAGGGAGG + Intergenic
986682188 5:10244075-10244097 TTGTGTCTCAGGAAATAGGAGGG + Intronic
987611740 5:20213184-20213206 TTGTATCTCAGAGAATAGGGAGG + Intronic
987615683 5:20270974-20270996 GCATATCTGAGGGCATAGGGTGG + Intronic
987715941 5:21571131-21571153 TTGTGTCTTAGGGAATAGGAGGG - Intergenic
987726664 5:21709427-21709449 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
987943810 5:24577739-24577761 TTGTTCCTGAGGCTATAGGACGG + Intronic
987952514 5:24693683-24693705 TTATGTCTCAGGGGATAGGAAGG - Intergenic
988889099 5:35595167-35595189 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
989634236 5:43517170-43517192 TTGTGTCTCAAGGAATAGGAAGG - Intergenic
990887491 5:60611339-60611361 TTGTGTCTGAGGGAATAGAGAGG - Intronic
991428334 5:66515653-66515675 TTGTATCTCAGGGAATAGGGAGG + Intergenic
992074562 5:73179061-73179083 TTGTGTCTCAAGGAATAGGAAGG - Intergenic
992414266 5:76537967-76537989 TTGTATTTGAGTGTAGAGGAGGG + Intronic
992510578 5:77429776-77429798 TTGTGTCTCAGGGAATAGGGAGG - Exonic
993368754 5:87065425-87065447 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
993897863 5:93559685-93559707 TTGTGTCTCAGGGAATAGGGTGG + Intergenic
994253622 5:97566636-97566658 TTGTATCTCAAAGAATAGGAAGG - Intergenic
994736767 5:103565551-103565573 CTGTATCTCAGGGAATAGGGAGG - Intergenic
995001608 5:107137965-107137987 TTGTGTCTCAGGGAATAAGAAGG + Intergenic
995005773 5:107193754-107193776 ATGTATCAGAGTGCAAAGGATGG + Intergenic
995214386 5:109578473-109578495 TTGTGTCTTAGGGAATAGGGAGG + Intergenic
995426168 5:112025901-112025923 TTGTATCTCAGGGAGTAGGAAGG - Intergenic
995592789 5:113716701-113716723 TGGTTTCTGAGTGCATAAGATGG + Intergenic
995896433 5:117017124-117017146 TAGTATCTTAGGGCATATTATGG - Intergenic
996119946 5:119660160-119660182 TTGTCTTGGAGGGCTTAGGAAGG + Intergenic
996209838 5:120794629-120794651 TTGTGTCTTAGGGAATAGGGAGG - Intergenic
996351965 5:122553864-122553886 TTGTATGTCAGGGAATAGGGAGG - Intergenic
996526384 5:124484568-124484590 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
996807444 5:127472604-127472626 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
997483936 5:134212507-134212529 TTGTGTCTCAGGGGATAGGGAGG - Intronic
999801201 5:155038768-155038790 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
999897103 5:156046725-156046747 TTGTAACTCAGGGAACAGGAAGG - Intronic
1000333395 5:160223775-160223797 TTGTGTCTCAGGGAATAAGAAGG - Intronic
1000453807 5:161423651-161423673 TTGTGTCTCAGGGAATAGGAAGG - Intronic
1000492609 5:161933361-161933383 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1000821267 5:165987290-165987312 TTGTATCTCAGGGAATAGAGAGG - Intergenic
1000886691 5:166755765-166755787 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1001183279 5:169541279-169541301 TTGTTTCTCGGGGAATAGGAAGG - Intergenic
1001655881 5:173349233-173349255 TTGTATCTCAGGGAATAAGGAGG - Intergenic
1002487189 5:179547264-179547286 TTGTGTCTCAGGGCACAGGGAGG + Intergenic
1003008056 6:2399961-2399983 TTGTATCTTGGGGAATAGGGAGG - Intergenic
1003275054 6:4643335-4643357 TTGTATCTCAGGGAATAGGAAGG + Intergenic
1003598763 6:7499341-7499363 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1004152838 6:13136747-13136769 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1004499982 6:16200651-16200673 TTGTATCTGCTGGCAAAGGCAGG + Intergenic
1004922813 6:20392850-20392872 TTGTGTCTCAGGGCATCGGGAGG + Intergenic
1004978594 6:20996492-20996514 TTGTATCTCAGAGGATAGGGAGG + Intronic
1005689893 6:28293823-28293845 TTGTGTCTCAGGACATAGCAAGG - Intronic
1006088921 6:31616327-31616349 TGATATCTGGGGGCAGAGGATGG - Exonic
1006592980 6:35171719-35171741 TTCTATCTCAGGGCCTAAGATGG + Intergenic
1006875672 6:37293561-37293583 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1007685281 6:43663555-43663577 TTGTGTCTCAGGGAATAGGGTGG + Intronic
1007863824 6:44945253-44945275 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1008268907 6:49466092-49466114 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1008516293 6:52322501-52322523 TTGTGTCTCAGAGAATAGGAAGG + Intergenic
1008772722 6:54999325-54999347 TTGTATCTTGGGGCCTAGGCAGG + Intergenic
1009000777 6:57710929-57710951 TTGTGTCTTAGGGAATAGGAGGG + Intergenic
1009387389 6:63101972-63101994 TTGTGTCTCAGGGAATAGAAAGG + Intergenic
1009627317 6:66151870-66151892 TTGTATCTCAGGGAATAGGGAGG - Intergenic
1010064808 6:71669849-71669871 TTGCATCTCAGGGAATAGGGAGG - Intergenic
1010168100 6:72941219-72941241 TTCTATCTGCATGCATAGGATGG + Intronic
1010168830 6:72950678-72950700 GTGTGTCGGAGGGCATTGGAGGG + Intronic
1010754814 6:79655171-79655193 TTAAAGCTGAGGGCATAAGAGGG + Intronic
1011060684 6:83263252-83263274 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1011218035 6:85026116-85026138 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1013172644 6:107650709-107650731 TTGTATCTCAGGAAATAGGGAGG - Intronic
1013266463 6:108504362-108504384 TTGTATCTCAGGGAATAGGGAGG + Intronic
1013569198 6:111403655-111403677 TAGTGTCTCAGGGAATAGGAAGG - Intronic
1013814450 6:114081043-114081065 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1014100296 6:117504379-117504401 TTGCATCTGTGGGGAGAGGAAGG + Intronic
1014478035 6:121899247-121899269 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1014509006 6:122297351-122297373 TTGTGTCTCAAGGAATAGGAAGG + Intergenic
1014847890 6:126301824-126301846 TAGAATCTGAGTGCATATGAAGG + Intergenic
1016397894 6:143646148-143646170 TTATGTCTGAGGTCATAGGCTGG + Intronic
1016571965 6:145523661-145523683 TTGTGTTTCAGGGAATAGGAAGG - Intronic
1016867395 6:148780995-148781017 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1016903271 6:149123206-149123228 TTGTATCTCAGGGAATATGGAGG - Intergenic
1018076588 6:160221674-160221696 TTGTGTCTTGGGCCATAGGAAGG + Intronic
1019367772 7:644142-644164 GTGTAGGTGAGGGCACAGGAGGG - Intronic
1019605244 7:1906952-1906974 TTTCATCTGAGGCCATGGGAAGG - Intronic
1020456336 7:8377480-8377502 CTGGATCAGAGGGCATATGAGGG - Intergenic
1020570675 7:9857069-9857091 TTGTATCTCAAGGAATAGGGAGG + Intergenic
1020833339 7:13118471-13118493 TTGTATCTCAGGAAATAGGGAGG - Intergenic
1021257993 7:18418007-18418029 TTCTATATGATGGCATAGGGAGG - Intronic
1021376564 7:19915119-19915141 TTGTGTCTGAGGACATAGAAAGG + Intergenic
1022144982 7:27528211-27528233 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1022804113 7:33804661-33804683 TTTTATCTGAAGGCAGTGGAAGG - Intergenic
1023193505 7:37609349-37609371 TTGTATCTCAGACAATAGGAAGG - Intergenic
1023515543 7:40997720-40997742 TAGGATCTGAGAGCTTAGGAAGG - Intergenic
1023724367 7:43126954-43126976 TTGTGTCTCAGGGAATAGGGTGG - Intronic
1023778455 7:43633385-43633407 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1024336697 7:48215243-48215265 TTGTGTCTCAGGGAACAGGAAGG + Intronic
1024500597 7:50101298-50101320 TTGTTTCTGTGGGCATAGGTTGG - Intronic
1024689351 7:51782289-51782311 TTGTATTTGACAGCATAAGAGGG + Intergenic
1024786141 7:52910522-52910544 TTGTGTCTCAGAGAATAGGAAGG + Intergenic
1024837895 7:53545414-53545436 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1026256113 7:68713339-68713361 TTTTGTCTCAGGGGATAGGAAGG + Intergenic
1026415342 7:70173893-70173915 TTGTGTCTCAGGGAATAGGAAGG - Intronic
1027357367 7:77371041-77371063 TGGCATTTGAAGGCATAGGAGGG - Intronic
1027512077 7:79095589-79095611 TTGTGTCTCAGGGACTAGGAGGG + Intronic
1027573447 7:79901646-79901668 TTGTATCTCAGGGAACAGGGAGG - Intergenic
1027810941 7:82896986-82897008 GTGTTTCTGAGGCCATAAGATGG + Intronic
1028300101 7:89188392-89188414 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1028372355 7:90107599-90107621 TTGTGTCTCAGGGAATAGGATGG + Intergenic
1028870532 7:95766717-95766739 TTGTATCTCAGGAAATAGGAAGG - Intergenic
1029980958 7:104878575-104878597 TTGTATCTCATGGAATAGGGAGG - Intronic
1030098732 7:105925392-105925414 TTGTGTCTCAGGGCATGGGGAGG + Intronic
1030172922 7:106622774-106622796 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1031057326 7:117006999-117007021 TTGTGTCTCAGGGATTAGGAAGG - Intronic
1031307381 7:120147934-120147956 TTGTGTCTTAGAGGATAGGATGG + Intergenic
1031588648 7:123563359-123563381 TTGTATCTCAGGGAATAGGAAGG + Intergenic
1031716114 7:125110528-125110550 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1031860221 7:126970868-126970890 TTGTGTCTCAGGGCATAGGGAGG + Intronic
1031878378 7:127167767-127167789 TTGTGTCTGAGGGAATAGGAAGG - Intronic
1032235514 7:130118763-130118785 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1032374902 7:131403673-131403695 TTGCATCTCAGGGAATAGGGAGG + Intronic
1032701607 7:134385204-134385226 TTGTGTCTCAGGGAATAGGAAGG - Intergenic
1032861764 7:135886478-135886500 TTGTATCTCAGGAAATAGGGAGG - Intergenic
1032984643 7:137324459-137324481 TTTTAGATGAGGGCTTAGGAAGG - Intronic
1033007935 7:137587511-137587533 TAGTATAACAGGGCATAGGAGGG + Intronic
1033119160 7:138651806-138651828 TTGTATCTGAGGGCATAGGAAGG - Intronic
1033140881 7:138825319-138825341 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1034134100 7:148749648-148749670 TTGTGTCTCAGGGAGTAGGAAGG - Intronic
1035387087 7:158480418-158480440 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1036469116 8:9034641-9034663 TTGTGTCTCAGGGAATAGGTAGG - Intronic
1036662825 8:10718912-10718934 CTGTATGTGAATGCATAGGAGGG - Intergenic
1037303726 8:17482446-17482468 TTGTATATCAGGGAATAGGGAGG - Intergenic
1037428675 8:18785808-18785830 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1040058082 8:43078641-43078663 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1040732402 8:50464459-50464481 TTGTGTCTCAGGGAGTAGGAAGG + Intronic
1040754043 8:50748882-50748904 TTGTGTCTGTGGGAATAGGGAGG - Intronic
1040774116 8:51018366-51018388 TTGTGTGTCAGGGAATAGGAAGG + Intergenic
1041131290 8:54704309-54704331 TTGTGTCTGAGGGAATAGAGAGG + Intergenic
1041450852 8:58005201-58005223 TTGTGTCTGAGAGGATAGGGAGG + Intronic
1041926254 8:63240078-63240100 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1042635707 8:70871665-70871687 TTGTGTCTCAGGGAACAGGAAGG - Intergenic
1042686742 8:71450376-71450398 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1042705976 8:71665952-71665974 TTGGAACTGAGGGTACAGGAGGG - Intergenic
1042882408 8:73508335-73508357 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1043601319 8:81941873-81941895 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1044267536 8:90200971-90200993 TTGTAGCTGAGGGAAAAGGTGGG + Intergenic
1045445150 8:102254442-102254464 TTGTGATTGAGGGCATAGGCTGG + Exonic
1045967052 8:108037001-108037023 TTGTACCACAGGGCATAGGGAGG - Intronic
1046064404 8:109179603-109179625 TTTAATCTGAGGGCATAGAGAGG - Intergenic
1046478303 8:114779094-114779116 TTTTGTCTCAGGGAATAGGAAGG - Intergenic
1047485632 8:125328286-125328308 TTGTTTATGAGGTCATGGGATGG + Intronic
1047663943 8:127069110-127069132 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1047827877 8:128597498-128597520 TTGGATCTCAGGGAATAGGAAGG - Intergenic
1047888798 8:129283475-129283497 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1048079452 8:131109588-131109610 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1048433389 8:134391500-134391522 TTGTATCTCAGGGAATAGGGAGG - Intergenic
1048604954 8:135957972-135957994 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1049028572 8:140014920-140014942 TTCTATATGAGAGCATGGGAAGG - Intronic
1049117742 8:140704384-140704406 TTGTCTCTAAGGGCTTAGAACGG - Intronic
1050383785 9:5061933-5061955 TTGTGTCTGAGGGAATAGGGAGG + Intronic
1050437311 9:5624754-5624776 TTGCATCTCAGGGGATAGGGAGG + Intergenic
1050649737 9:7763131-7763153 TTGTGTTTCAGGGGATAGGAAGG - Intergenic
1050788564 9:9436312-9436334 TTGGGTCTCAGGGAATAGGAGGG - Intronic
1051123756 9:13780407-13780429 TTATGTCTCAGGGAATAGGAAGG - Intergenic
1051201529 9:14631727-14631749 TTGTATCTTAGGGAATAGCAAGG + Intronic
1051254136 9:15194888-15194910 TTTTGTCTGAGGGAATAGGGAGG - Intronic
1051967936 9:22851773-22851795 CTGTATCTCAGGGAATAGGGAGG + Intergenic
1052423787 9:28277396-28277418 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1053113759 9:35484326-35484348 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1053465626 9:38306049-38306071 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1054839419 9:69719993-69720015 TTGTATCTCAGGGAACAGGGAGG - Intronic
1056093786 9:83230722-83230744 CTGTATCTCAGGGAATAGGGAGG + Intergenic
1058223634 9:102333464-102333486 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1058271087 9:102972262-102972284 TTGTACATGAGGTCCTAGGAAGG + Intergenic
1058638799 9:107063195-107063217 TTGTGTCTAAGGGAATAGGGAGG + Intergenic
1059264758 9:113016726-113016748 TTTTATCTCAGGGAATAGAAAGG - Intergenic
1059848991 9:118315608-118315630 TTGTATGTGGAGCCATAGGAAGG - Intergenic
1060066453 9:120505409-120505431 TTGTATCATAGGGCATAGGGAGG - Intronic
1061494585 9:130964846-130964868 TTGTATCTTAGGGAATAGGGAGG - Intergenic
1186076434 X:5884625-5884647 TGGTATCCGAGGACAGAGGAAGG + Intronic
1186613010 X:11156848-11156870 TTGTATCTCCAGGCATATGAGGG - Intronic
1186942337 X:14523661-14523683 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1187311028 X:18142902-18142924 TTTTGTCTAAGGGAATAGGAAGG - Intergenic
1187800409 X:23056063-23056085 TTGTTTCTTAGGGAATAGGGAGG - Intergenic
1188231036 X:27663648-27663670 TTGTGTCTCAGGGAGTAGGAAGG - Intronic
1188583329 X:31742465-31742487 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1188855618 X:35191660-35191682 TTGTATCCCAGGGAATAGGGAGG + Intergenic
1188970430 X:36608492-36608514 TTGTCTTTCAGGGCATGGGATGG + Intergenic
1189788016 X:44577071-44577093 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1189923090 X:45922735-45922757 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1189965071 X:46364092-46364114 TTGTATCTCAGGAAATAGGGAGG + Intergenic
1190141925 X:47854615-47854637 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1190189505 X:48265437-48265459 CTGTATCTCAGGGAATAGGTAGG + Intronic
1190460815 X:50672005-50672027 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1191952108 X:66603698-66603720 TTGTATCTGAGGAGGTAGGGAGG + Intronic
1192301919 X:69913860-69913882 TTGTGTCTCTGGGAATAGGAAGG + Intronic
1194100490 X:89697312-89697334 TTGTCTCTCAGGGAATAGGGAGG + Intergenic
1194472600 X:94316060-94316082 TAGTATGTGAGGGCATAGCAAGG - Intergenic
1194759810 X:97782548-97782570 TTGTGTCTCAGGGAATAGGAAGG - Intergenic
1195338735 X:103883485-103883507 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1195902728 X:109815597-109815619 TTGTGTCAGAGTGCACAGGATGG + Intergenic
1195902768 X:109815909-109815931 TGGTATGTGAGGGCACAGGTTGG + Intergenic
1196333373 X:114498944-114498966 TTGTGTCTCAGGAAATAGGAAGG + Intergenic
1196578029 X:117343866-117343888 TTGTGTCTCAGGGAATAGGAAGG + Intergenic
1196619090 X:117801677-117801699 TTGTGTCTTAGGGGATAGGGAGG + Intergenic
1196721361 X:118857475-118857497 TTGTATTTCAGGGAATAGGGAGG - Intergenic
1197423278 X:126264618-126264640 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1197529218 X:127602057-127602079 TTGTATCTCAGAAAATAGGAAGG - Intergenic
1197561577 X:128029119-128029141 TTGAATCTCAGGGGACAGGAAGG + Intergenic
1198730626 X:139723767-139723789 TTGTATCTGACTGCATCTGATGG + Intergenic
1198763891 X:140061834-140061856 TGGTATCTGGGGGTTTAGGATGG + Intergenic
1199054384 X:143275468-143275490 TTGTAACTTAGGGAATAGGGAGG - Intergenic
1201143731 Y:11050015-11050037 TTGTGTTTTAGGGCATAGGGAGG - Intergenic
1201518800 Y:14849365-14849387 TGGTATTTGAGGACAGAGGAAGG - Intergenic
1201984459 Y:19950479-19950501 TTCTAACTGAGGGCAGAGGGTGG - Intergenic
1202594141 Y:26519530-26519552 TTGTGTCTCAGGGAATAGGGAGG - Intergenic