ID: 1033119664

View in Genome Browser
Species Human (GRCh38)
Location 7:138656405-138656427
Sequence TACCTGCCTTTGGCATCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 1, 2: 1, 3: 16, 4: 127}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033119664_1033119667 8 Left 1033119664 7:138656405-138656427 CCATAGGATGCCAAAGGCAGGTA 0: 1
1: 1
2: 1
3: 16
4: 127
Right 1033119667 7:138656436-138656458 ACGTTGCCTTACCTGAGACAAGG 0: 1
1: 0
2: 0
3: 4
4: 83
1033119664_1033119668 9 Left 1033119664 7:138656405-138656427 CCATAGGATGCCAAAGGCAGGTA 0: 1
1: 1
2: 1
3: 16
4: 127
Right 1033119668 7:138656437-138656459 CGTTGCCTTACCTGAGACAAGGG 0: 1
1: 0
2: 1
3: 3
4: 78
1033119664_1033119671 25 Left 1033119664 7:138656405-138656427 CCATAGGATGCCAAAGGCAGGTA 0: 1
1: 1
2: 1
3: 16
4: 127
Right 1033119671 7:138656453-138656475 ACAAGGGTAACATATAGCCTCGG 0: 1
1: 0
2: 0
3: 14
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033119664 Original CRISPR TACCTGCCTTTGGCATCCTA TGG (reversed) Intronic
900535324 1:3174190-3174212 TCCCTGCCTCTGTCATCATATGG + Intronic
900939901 1:5791999-5792021 CACCTGACTTTGCCATCCTCTGG + Intergenic
903276699 1:22226451-22226473 CACCTGTCTTTCGGATCCTAAGG + Intergenic
906180022 1:43810215-43810237 TTCCTGTGTTTGGCATCCTTGGG - Intronic
906754494 1:48296786-48296808 TACCTGCCAATGTCATCCTAAGG - Exonic
907789230 1:57645521-57645543 TATCTGCCTTTTGCATTTTAAGG + Intronic
907824157 1:57999472-57999494 TTCCTGGCTATGGGATCCTAGGG - Intronic
910427356 1:87130789-87130811 TATCTGCCATTGGCTTCCTGGGG - Intronic
912489593 1:110054749-110054771 TGCCTGCCTTTCCCATCCTGGGG + Intronic
912939645 1:114033544-114033566 GACCTTCCATTGGCATCCTACGG + Intergenic
914248985 1:145906603-145906625 TACCTACCTTTTGCTTTCTAGGG + Intronic
915031389 1:152883104-152883126 TTCCAGCCTCTGGCATCCTTGGG - Intronic
920337943 1:205257537-205257559 TCCCAGCATTTGGCAGCCTAAGG - Intronic
920806638 1:209240741-209240763 TACCTGCCTATGTTATCCTGGGG + Intergenic
923515628 1:234695717-234695739 GACCTGCCTGTGCCATCCTGGGG + Intergenic
1063008466 10:1997490-1997512 TCCCTGCCACTGGCATCCTGGGG + Intergenic
1063238164 10:4141064-4141086 TTTCTGCCTTTGGAAGCCTAAGG - Intergenic
1065634294 10:27714987-27715009 TTCCTGCCTTTGGCATTCTGAGG + Intronic
1065909578 10:30290222-30290244 GACCTCCCTTTGTCATCCCAGGG - Intergenic
1066376708 10:34863759-34863781 TCCCTGCCTTTGGGAGGCTAAGG + Intergenic
1067004917 10:42651548-42651570 TACCTGCATTTGTCTTCCTAGGG - Intergenic
1067350220 10:45468918-45468940 TATGTGCCTTTGTCATCCTGAGG - Intronic
1068008838 10:51422326-51422348 CACCTAGCTGTGGCATCCTATGG - Intronic
1068069937 10:52183226-52183248 TACCTGCCTGGGGCAGCCCACGG + Intronic
1068575511 10:58679857-58679879 AACCTGCCTTGCGCATCCCAGGG - Intronic
1070653209 10:78252930-78252952 TCCCTGCATTTGGCATCCGTTGG + Intergenic
1072632304 10:97154734-97154756 TACCTGCTCTTGGCACCCTATGG - Intronic
1076019110 10:127055940-127055962 TACCTGCCTTTGTCCTGGTATGG + Intronic
1076438707 10:130464442-130464464 TACCTGTCTGTGTCTTCCTAGGG + Intergenic
1081576503 11:44321791-44321813 TCCCTGCCTTTGTCTTCCCAAGG + Intergenic
1083664403 11:64266729-64266751 TCCCTGGCTTTGGCGTCCTTGGG + Intronic
1086498727 11:87430692-87430714 TCTCTGCCTTTGACATCCTCAGG + Intergenic
1093071597 12:14711178-14711200 AACCACGCTTTGGCATCCTAGGG - Intergenic
1097235739 12:57538250-57538272 TACCTGGCGCTGGCATCCTCTGG + Intronic
1098824315 12:75274210-75274232 GACCTGCATATGTCATCCTAGGG - Intergenic
1101988273 12:109464135-109464157 GACCTCTCTTTGCCATCCTAAGG + Intronic
1102666283 12:114576223-114576245 TTCCTGCCTTTGGGAGCCAATGG - Intergenic
1104415312 12:128592865-128592887 CCGCTGCCTTTGGGATCCTAGGG + Intronic
1104752277 12:131247402-131247424 TCCATGCCTTTGACATCCTCTGG - Intergenic
1104992768 12:132635384-132635406 TACCTGCCTGTGCCCTCCAATGG + Intronic
1105996843 13:25680689-25680711 TAACTGCTCTTGTCATCCTAAGG + Intronic
1108250810 13:48565996-48566018 TTCCTGCCTTTTGTGTCCTAGGG + Intergenic
1115021887 14:28691820-28691842 TAAATGCCTTTTGCATCATATGG - Intergenic
1118065221 14:62183651-62183673 TTACTGCCTTTGTTATCCTAGGG - Intergenic
1118156586 14:63248467-63248489 TAGCTCCCTTTGTCATTCTAAGG + Intronic
1121555651 14:94834755-94834777 TCTCTGCCTTTGTCATCCCATGG - Intergenic
1122925967 14:104900466-104900488 TTCCTGCTTTTGAAATCCTACGG - Intergenic
1124546845 15:30636814-30636836 TCCCTGCCTATGTCATCCCATGG + Intronic
1126176855 15:45743807-45743829 TTACTGCCTTTGTCATCCTGTGG - Intergenic
1129308829 15:74690341-74690363 TACCTGACTTTGTTATCCAAAGG - Intronic
1130330010 15:82914806-82914828 TTCCTCCCTTTGTCCTCCTAAGG - Intronic
1134803851 16:17108499-17108521 AACCTGCCTTTGGCAAGCTGCGG - Exonic
1135480238 16:22815391-22815413 TCCCTTCCTTGGGCACCCTAAGG - Intronic
1138052031 16:53788720-53788742 TACCTGTCTTTAGTATCATAGGG + Intronic
1143954110 17:10655549-10655571 AACCTGCCTTTTGCTTCCTTGGG + Intronic
1144046853 17:11461724-11461746 TACCTGCCTTAGTAATCCCAGGG - Intronic
1144424610 17:15130164-15130186 CACCAGGCTTTGGCATCCAATGG + Intergenic
1149639847 17:58195463-58195485 CCCCTGCTTTTGGCAACCTAAGG + Intronic
1150060979 17:62067981-62068003 TACCTGCCATTGGAATCCTGAGG - Intergenic
1151484281 17:74388840-74388862 TACCTTCCTTTGGCTTCGAAAGG + Intergenic
1152658467 17:81530768-81530790 CACCTGCAGTTGGCATCCTCGGG + Intronic
1154377222 18:13820319-13820341 TGCCTGCCTTTGGGATCCCAGGG + Intergenic
1155976094 18:32133424-32133446 TACCTACATTTGGCATCCCCAGG - Intronic
1157216398 18:45787056-45787078 TCTCTGCCTTTGGCAGCTTAGGG - Intergenic
926655440 2:15399466-15399488 TACCTGCCTTTGGCTGCCTATGG + Intronic
928889417 2:36185889-36185911 TACCTGGCTTTGGCAGCACAAGG - Intergenic
931962307 2:67495422-67495444 TAGCTTCCATTGGCATCCAAGGG + Intergenic
935041376 2:99431579-99431601 TACCTGACTTTGGTATCTGAAGG + Intronic
935840360 2:107102538-107102560 TACCTGCCTTTATCAGCTTAAGG - Intergenic
936918227 2:117661615-117661637 CACCTGCCTGTTGGATCCTATGG - Intergenic
937255509 2:120552636-120552658 TACCTGCCTTTGTCATCAGCTGG - Intergenic
941203958 2:162548294-162548316 TTCCTGCCTCTGGCAGCCTTAGG - Intronic
942352890 2:175071966-175071988 CACCTGCCTTTGGCATCCCTTGG - Intergenic
945819364 2:214645099-214645121 TAACTGCTGTTGGCATTCTAGGG + Intergenic
946097274 2:217286151-217286173 GACCTAAATTTGGCATCCTATGG - Intronic
946731941 2:222718369-222718391 TACCTGGCATTGGCATTTTATGG + Intergenic
948124737 2:235556319-235556341 TACCTGCCTTCTGCATTCTGGGG + Intronic
1170129864 20:13007822-13007844 TACCTGCCTTTACCATCCCAAGG - Intergenic
1171069940 20:22058694-22058716 TACCTGCCTTCAGCCTTCTAGGG - Intergenic
1173315469 20:41939200-41939222 TATATGCCTGTGGAATCCTAAGG + Intergenic
1174343051 20:49909936-49909958 TACCGGCCTTTGACAGCCTGCGG + Intronic
1174368032 20:50068199-50068221 TACCTGGCTGTGCCATCCAAAGG - Intergenic
1174991571 20:55516285-55516307 TTCCTGCCTTTGCCATTGTAAGG + Intergenic
1175259764 20:57667145-57667167 TGCCTGCATTTGGGATCCAAGGG + Intronic
1178175340 21:30090967-30090989 TACCTGCCATTGGTTTCCCAAGG + Intergenic
1179552055 21:42149805-42149827 TACCTGCCTCTGCCATCGTCAGG - Intergenic
1182324927 22:29505293-29505315 TACCTGCCTTTGGAATTCAAAGG + Intergenic
950443841 3:13024789-13024811 TATCTGTCTTTGCCATCCTCGGG + Intronic
951749098 3:26013964-26013986 GACCTGCCATGGGTATCCTAGGG + Intergenic
953518287 3:43618228-43618250 TACCTTCCTGTGGAATCTTAAGG - Intronic
954863389 3:53708880-53708902 TACCTGTGTTGGGCATCTTAGGG - Intronic
955220598 3:57020140-57020162 TACCTGCCTTGGCCTTCCCAAGG + Intronic
956534444 3:70260247-70260269 TCTCTGCCTTTGTCATCGTACGG + Intergenic
956907974 3:73786687-73786709 TGCCTGCCTTCTGCATCCTTTGG - Intergenic
966468110 3:180255344-180255366 CACCTGACTTTGGCTTCCCAGGG - Intergenic
969642713 4:8408835-8408857 GACTTGCCATTGGCATCCAAAGG + Intronic
971971534 4:33626613-33626635 TACCTTCCTGTGGCAGCTTATGG + Intergenic
973181383 4:47273055-47273077 TACCTACCTACAGCATCCTAAGG + Intronic
973218258 4:47696249-47696271 AATCTCCCTTTGTCATCCTAAGG - Intronic
973703056 4:53555129-53555151 TGCCTGCTTTTGGGATCCTATGG + Intronic
975624161 4:76326211-76326233 GACCTGCCCTTGGGATCCTGAGG + Intronic
988995683 5:36712880-36712902 TTCCTGACTTTGGCAGTCTATGG - Intergenic
990417139 5:55597352-55597374 TCCCTGGCTTTGTCATCCTTTGG - Intergenic
992181150 5:74199732-74199754 TTCCTCCCTTTGGCATCCTCTGG - Intergenic
993500785 5:88664219-88664241 TACATGCCTTTGGAATATTACGG + Intergenic
995891827 5:116962332-116962354 AATCTGACTTTGGTATCCTAAGG + Intergenic
997863265 5:137438717-137438739 TACCTTCCTTTTGGAACCTATGG - Intronic
998398382 5:141834542-141834564 CACCTGGCTTTTGCATCCTAGGG - Intergenic
1001419089 5:171573520-171573542 CCCCTGCATTTGGGATCCTATGG - Intergenic
1002845801 6:943179-943201 TTCCTGCCTTTTGCACCCTCAGG - Intergenic
1003499022 6:6688856-6688878 TACTTGCCTTTGGCAGCCTCAGG - Intergenic
1004324293 6:14659993-14660015 TACCTGGCTTAGTCCTCCTAGGG + Intergenic
1007718235 6:43869690-43869712 TGCCTGCCGCTGGCATCCTGTGG - Intergenic
1010801219 6:80177796-80177818 TGCCTACCTTTAGCTTCCTAAGG - Intronic
1015963944 6:138679176-138679198 TGCCTGCTTTTGGCAACATATGG - Intronic
1018297547 6:162365511-162365533 TACCTGTCTTTGTCTTCCTCTGG + Intronic
1018883960 6:167916186-167916208 TCCCTGCCTTTGTCTTCGTACGG + Intronic
1021627119 7:22604173-22604195 TACCTAACATTGGAATCCTATGG - Intronic
1024410000 7:49029376-49029398 TACCTGCCACTGGCATCTGAAGG - Intergenic
1024723422 7:52164961-52164983 TTCCTGCCTTTGACATCTAAAGG + Intergenic
1027965541 7:85001178-85001200 GACCTGCCTTTGGCCTCAAATGG - Intronic
1028715130 7:93956895-93956917 TACCTGCCTTTGGTATCCTATGG - Intergenic
1030746042 7:113167431-113167453 TACCTGCCCTAGTCATCCCAAGG - Intergenic
1030996298 7:116362344-116362366 TAGCTGACTGTGGCTTCCTAGGG + Intronic
1033119664 7:138656405-138656427 TACCTGCCTTTGGCATCCTATGG - Intronic
1035061702 7:156074276-156074298 TACCTGCCTTTGCTCTCTTACGG + Intergenic
1036046941 8:5153434-5153456 TCCCTGCCTTTGCCAGCCTTTGG - Intergenic
1037680135 8:21090230-21090252 GACCTGCCTTTGACAGCCTCAGG + Intergenic
1041854930 8:62440796-62440818 TACTTGCCTCTGGCAGCCCATGG - Intronic
1045379923 8:101613035-101613057 TACCTGCCTTGACCATCCCATGG - Intronic
1047666967 8:127102060-127102082 TATCTGCCTTTGTCCTCCTGAGG - Intergenic
1059427105 9:114228074-114228096 GACCTGCCATGGGCATCCCATGG - Intronic
1059880870 9:118687392-118687414 TACCTGCCTGTTGCATTCTAAGG - Intergenic
1061475583 9:130863703-130863725 TTCCTTCCCTTGGCGTCCTAAGG - Intronic
1062030318 9:134359248-134359270 CACCTGCCTTTGGGGTCCTCAGG + Intronic
1185712466 X:2314912-2314934 TCCCTCGCTTTGGCATCCCAAGG - Intronic
1188346439 X:29072284-29072306 TAACTGCCTTTTTCCTCCTATGG - Intronic
1190562205 X:51696768-51696790 TCCCTGCCCTTAGCATCTTAGGG - Intergenic
1192168727 X:68841594-68841616 TCCTTACCTTTGGCATCCTTTGG + Exonic
1198680775 X:139179910-139179932 TCCCTGCTTTTGGCATACTATGG - Intronic
1199947644 X:152681119-152681141 TCCCTGCCTGTGGCCTCCCAGGG - Intergenic
1199962035 X:152787335-152787357 TCCCTGCCTGTGGCCTCCCAGGG + Intergenic
1200181309 X:154152168-154152190 TTGCTGCCTTTGTAATCCTATGG - Intronic
1200186955 X:154189282-154189304 TTGCTGCCTTTGTAATCCTATGG - Intergenic
1200192605 X:154226420-154226442 TTGCTGCCTTTGTAATCCTATGG - Intronic
1200198360 X:154264224-154264246 TTGCTGCCTTTGTAATCCTATGG - Intronic