ID: 1033120451

View in Genome Browser
Species Human (GRCh38)
Location 7:138663294-138663316
Sequence CCCTGAGGCCCTTCATGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 198}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033120451 Original CRISPR CCCTGAGGCCCTTCATGTTC AGG Intronic
900192089 1:1356113-1356135 CCCTGAGGCCCCTCGTGGTGGGG + Intronic
902342478 1:15793028-15793050 CCCTGAGGGCTTTGATGATCAGG - Intergenic
903500524 1:23797853-23797875 CCCCGTGGGCCTTCATGATCTGG + Exonic
904245930 1:29188150-29188172 CCTTGAGGCCCCTCAAGATCTGG - Intergenic
904464346 1:30699011-30699033 CCCTGGGGCCCTGCAGGCTCTGG - Intergenic
905995820 1:42380349-42380371 CCCCGAGGCCCTCCCTGTCCGGG + Intergenic
907519459 1:55013769-55013791 ATTTGAGGCCCTTCATGATCTGG + Intergenic
908305541 1:62811632-62811654 CTCTTAGGCCCATCATGTCCTGG - Intronic
908715581 1:67066634-67066656 CCCAGAAGCCCTACATGTTGTGG + Intergenic
909417125 1:75418676-75418698 CACAGAGGCCCTGCATGATCTGG - Intronic
910145206 1:84071890-84071912 CTCTGAGGCCCAACATGTTTGGG + Intergenic
910670171 1:89764273-89764295 CCTGGAGGCCCTACATGATCTGG + Intronic
911048020 1:93644689-93644711 CTCTGAGGCCCCACATGTTTGGG - Intronic
912858577 1:113193048-113193070 TTATGAGGCCCTTCATGATCTGG + Intergenic
913064542 1:115238499-115238521 ACCTGAGGCCCTTCAGTTCCTGG + Intergenic
914877631 1:151524229-151524251 CCAAGAGGCGCTTCATGTTCTGG - Exonic
915270419 1:154749777-154749799 TCCTCAGGCCCCTCATGCTCAGG - Intronic
915515347 1:156409464-156409486 CAGTGAGGCCGTTCATGGTCTGG - Intronic
915612637 1:157006836-157006858 CACTGGGGCCCTTCATCTTCTGG - Intronic
916329339 1:163596565-163596587 CTCTGAGGCCCCACATGTTTGGG + Intergenic
920377448 1:205516785-205516807 CCCAAAGGCCCTTCAAGATCTGG - Intronic
920949843 1:210562438-210562460 TCCTGAGGCCATTCATGATTTGG + Intronic
923655230 1:235910045-235910067 CCGTGAGTCCCTTCATCTCCAGG - Intergenic
924553252 1:245097930-245097952 CCACAAGGCCCTTCATGCTCGGG - Intronic
1067232496 10:44421889-44421911 CCCTCAGCCCCTCCCTGTTCTGG - Intergenic
1069610770 10:69771117-69771139 CCCAGAGGCACTTCCTCTTCAGG + Intergenic
1069776036 10:70927735-70927757 CCCTGGGCCACTTCCTGTTCTGG + Intergenic
1069908257 10:71744776-71744798 CCCTGAGGCCATCCATCTCCAGG + Intronic
1070603220 10:77880063-77880085 CCCTTAGCCCCTGCATGCTCAGG - Intronic
1071528522 10:86372329-86372351 CTCTGTGGCACTTCATGTTCTGG - Intergenic
1075446110 10:122514287-122514309 CCCTGCGGACCACCATGTTCAGG - Exonic
1076581313 10:131513796-131513818 CACTGCGGCACTTCATGCTCTGG + Intergenic
1076687309 10:132203969-132203991 ACCTGAGGCCCTGGATGCTCCGG - Intronic
1078734982 11:14011632-14011654 TTATGAGGCCCTTCATGATCTGG + Intronic
1078924212 11:15859405-15859427 GCCAGAGGCCCTTCATGGTAGGG - Intergenic
1080678379 11:34449263-34449285 CCGTGGGCCCCTTCTTGTTCAGG + Exonic
1081466554 11:43324397-43324419 TCCTGAGGCCATGCATCTTCTGG + Intronic
1081675222 11:44964746-44964768 CCTTGAGGCCCTTTTGGTTCAGG - Intergenic
1082807374 11:57459574-57459596 CCCTCTGGCCCTTCATGGCCTGG - Intergenic
1083684202 11:64366530-64366552 CATTGAGGCCCTTCATGATGTGG + Intronic
1083764351 11:64834963-64834985 CCCTGAGCCCCTTCCCATTCAGG - Exonic
1087455735 11:98383853-98383875 GCCTGAGGCCCCACATGTGCAGG + Intergenic
1089661773 11:119990775-119990797 ACCACAGGCCCTGCATGTTCAGG + Intergenic
1091225252 11:133953272-133953294 GCCTGTGGCCCTGCATGTGCTGG - Intronic
1091297132 11:134481942-134481964 CCCTGGGGCCCTGCCTCTTCAGG + Intergenic
1092218285 12:6697300-6697322 CCCTGCGGCCATTCCTGTTCGGG - Exonic
1092735948 12:11583091-11583113 CTCAGAGGCTCTTCAAGTTCAGG - Intergenic
1094676777 12:32628257-32628279 CTCTGAGGCCCATCATCATCTGG - Intronic
1099474902 12:83096299-83096321 CCTTTAGGCCCTGCATGATCTGG + Intronic
1101641939 12:106592548-106592570 TCCTGATGCCCTTCCAGTTCTGG + Intronic
1104065195 12:125299983-125300005 GCCTGAGGCCCTGCAGGGTCTGG + Intronic
1104628834 12:130382206-130382228 CCACGAGGCCCTTCCTGATCTGG + Intergenic
1105608463 13:21946915-21946937 CCCTCAGGCACTTCTTGATCAGG + Intergenic
1110815348 13:79854827-79854849 CCCTGAAGCCTACCATGTTCAGG + Intergenic
1117205434 14:53437976-53437998 CCCTGAGTTCATTTATGTTCTGG + Intergenic
1117660171 14:57996231-57996253 CCCTGAGGCCCTCCAGAATCTGG + Intergenic
1121822889 14:96985751-96985773 CCTTGAGACCCTTCATCTTCTGG + Intergenic
1122240356 14:100361243-100361265 CCTTGAGGGCCTTCCTGCTCAGG - Intronic
1123029782 14:105446241-105446263 CACTGAGGCCCTTCATGTGTCGG + Intronic
1124639507 15:31388121-31388143 CACCCAGGCCCATCATGTTCAGG - Intronic
1125888713 15:43249674-43249696 CCCTCAGGCTCTTCCTGTTCTGG - Intronic
1128206595 15:65858210-65858232 CCATGAGGCCCTTCAAGATCTGG + Intronic
1128251409 15:66166559-66166581 CCCAAAGGCCCTTCATGATCTGG + Intronic
1129030273 15:72612549-72612571 CCCTGATGCCCTTCTTGTAGGGG - Intergenic
1131059695 15:89397172-89397194 CCCTGAGGACCTGCTTGTTTGGG + Intergenic
1132651702 16:1024131-1024153 TCCTCAAGGCCTTCATGTTCTGG + Intergenic
1134357250 16:13493940-13493962 CCCCAAGGGCCTTCAGGTTCTGG + Intergenic
1134559119 16:15192593-15192615 GCCTGAGGCCCTGCACGATCTGG + Intergenic
1134919655 16:18104206-18104228 GCCTGAGGCCCTGCACGATCTGG + Intergenic
1136412214 16:30084063-30084085 CCCTGAGACCCCTCATTTTGTGG + Intronic
1137566380 16:49535138-49535160 CTCTGAGGCCTTTCAGGTTAGGG - Intronic
1138320343 16:56105992-56106014 CTCTAAGGCCCCTCATGATCTGG - Intergenic
1138615842 16:58165629-58165651 CCCTGAGGCCCTAGATCTTCTGG - Exonic
1139239972 16:65381172-65381194 CCCTGATCACCTTCAAGTTCAGG - Intergenic
1139477594 16:67210412-67210434 CCCCGAGGCCCTGCAGGCTCTGG - Exonic
1140181948 16:72729004-72729026 CCCTCAGGTCCTTGATGGTCTGG - Intergenic
1140312977 16:73866972-73866994 CCCTGAGGGCATTCAATTTCTGG + Intergenic
1141090767 16:81128914-81128936 TCCTGAGATCCTTCATGATCTGG + Intergenic
1141603289 16:85139005-85139027 CCCTGAGCCCCTTCGTCTACCGG - Intergenic
1141762258 16:86036364-86036386 CCCTGACACCCTTCATGTTGAGG - Intergenic
1142227221 16:88883428-88883450 CTCTGAGGCCCATCCTATTCGGG + Intronic
1142737818 17:1912703-1912725 CCCTGAGTCCCTTCTCGTTGAGG - Intergenic
1144021929 17:11245415-11245437 CCCTGAGGGGCTTTTTGTTCTGG + Intronic
1144495855 17:15744312-15744334 ACCTGAGGCCCTTGACGTGCAGG - Exonic
1144589938 17:16515358-16515380 ACCAGAGGCCCTTCATGGCCGGG + Intergenic
1144632045 17:16878888-16878910 ACCTGAGGCCCTTGACGTGCAGG + Intergenic
1144743564 17:17598120-17598142 CCCTGAGGTCCTGGATGGTCCGG + Intergenic
1145081888 17:19901059-19901081 CCCTGAGGGCATTCATGTTCAGG - Intergenic
1145248548 17:21285090-21285112 CCCGGAACCCCTTCCTGTTCGGG + Intronic
1146102768 17:30001142-30001164 CCCTGTGGCCCTGCATGGTGTGG + Intronic
1147183964 17:38703979-38704001 GCCCCAGGCCCTTGATGTTCCGG + Intergenic
1147569233 17:41557506-41557528 CCCTGACGCCCTTCATGGGCGGG - Intergenic
1147716867 17:42514410-42514432 CCGAGAGGCCCTCCATGATCAGG - Exonic
1147746452 17:42697690-42697712 AGCTGAGGCCCTTCGAGTTCAGG + Exonic
1150440590 17:65188244-65188266 CCAAGAGGGGCTTCATGTTCAGG - Intronic
1151205984 17:72507211-72507233 CCCAGAAGCCCTCCATGTCCAGG - Intergenic
1151544712 17:74785670-74785692 CCCTCAGTGCCCTCATGTTCGGG - Intronic
1151870188 17:76831453-76831475 GCCTGAGGACCTTGGTGTTCAGG - Intergenic
1151953087 17:77366012-77366034 CCCTGGGGCCCTTGGTGTCCTGG - Intronic
1152922137 17:83071431-83071453 CCCCACGGCCCTTCATGCTCCGG + Intergenic
1153054174 18:929224-929246 CCCTGAGCCCCTTCATGTTAGGG - Intergenic
1153994746 18:10430945-10430967 TCCTGAGTTCTTTCATGTTCAGG - Intergenic
1154111488 18:11572152-11572174 TCCTGAGCCCCTGCATATTCTGG - Intergenic
1156476672 18:37409909-37409931 CCCTGAGGCGCTGCATGTGAAGG - Intronic
1157220217 18:45824167-45824189 ACAGGAGGCCCTTCAGGTTCAGG - Intergenic
1159826732 18:73221889-73221911 CTATGAGGCTCTTCCTGTTCAGG + Intronic
1160397052 18:78580244-78580266 CCCGGGGGCCCTTCATCTGCAGG - Intergenic
1160622167 18:80179188-80179210 CCCTCAGGCCCTTCCTGTGAAGG - Intronic
1166762932 19:45235820-45235842 CTCTGATGCCCTCCACGTTCTGG - Intronic
925305392 2:2844779-2844801 CCCCCAGGCCCTGCATGTACTGG - Intergenic
926144481 2:10388292-10388314 CACTGAGGCACCTCCTGTTCTGG - Intronic
927325878 2:21804506-21804528 CCCTGAGGCCCTTCAGTCTTTGG - Intergenic
932365481 2:71150211-71150233 TCCCCAGGCCCTTCCTGTTCAGG + Intergenic
932585054 2:73022493-73022515 TCCTGGGGCCCTTCTGGTTCTGG - Intronic
933245933 2:79974987-79975009 CCCTGAGGCCCAGAGTGTTCAGG + Intronic
934729919 2:96650001-96650023 CCATGGGCCCCTTCATGCTCAGG - Intergenic
935974064 2:108560093-108560115 CCCTGTGGCCCATCATCTGCTGG - Intronic
938292030 2:130155536-130155558 CCCTGAGCCCCCTCAGGCTCTGG - Intronic
942960955 2:181829441-181829463 CCCAGATCCCCTTCATGATCAGG - Intergenic
947276844 2:228401612-228401634 TCCTGAGGCCCCTCAGGGTCAGG + Intergenic
948194538 2:236085567-236085589 CCCAGAGGCCCAGCATGCTCAGG + Intronic
948464848 2:238147520-238147542 CCCCCAGGCCCCTCATGTGCTGG - Intronic
1172906547 20:38374260-38374282 CCCTCAGGCCCCTCATGGTAGGG - Intronic
1173231621 20:41203248-41203270 CTCTGGAGCCCTTCAAGTTCCGG + Exonic
1174526514 20:51176169-51176191 CTCTGAGGCACTTCCTGGTCTGG + Intergenic
1176271768 20:64239122-64239144 CCCTGAGGCCTTTGGTGTCCAGG - Intronic
1176376172 21:6087804-6087826 CCCTGAGGCCAGTCCTGTGCTGG + Intergenic
1176389304 21:6155392-6155414 CCCGGAAGCCATTCCTGTTCTGG - Intergenic
1176659036 21:9616481-9616503 CTCTGAGGCCATCCATGGTCTGG - Intergenic
1178158238 21:29880006-29880028 CCCTGGGGGCCTTCATATTATGG + Intronic
1179734166 21:43382846-43382868 CCCGGAAGCCATTCCTGTTCTGG + Intergenic
1179747303 21:43450440-43450462 CCCTGAGGCCAGTCCTGTGCTGG - Intergenic
1179787290 21:43737212-43737234 CCCTGACGCCCTTCAGGCTGGGG + Intronic
1182518267 22:30871154-30871176 CTCTGAGGCCCTTCTAGCTCAGG - Intronic
1182795034 22:32985677-32985699 CCCTGGCGTCCTTCATGATCTGG + Intronic
1203293897 22_KI270736v1_random:22096-22118 CCCTGAGGCCCTGCATTGTAGGG + Intergenic
953404321 3:42653131-42653153 TCCTGAGGCCCTACGTATTCTGG + Intergenic
954895610 3:53972615-53972637 CCGTGAGGCCCTGCCTGATCTGG + Intergenic
954945594 3:54421500-54421522 CCCTGAGGCCCTCCTGGCTCAGG - Intronic
959154210 3:102647104-102647126 CCTTGAGACCCTCCATGTTCTGG + Intergenic
961380715 3:126494915-126494937 CCCTGTGGCCCTGCTTGTACAGG - Intronic
963039260 3:141056730-141056752 CCCTGAGGCCCAGCATGTCTGGG - Intronic
966351320 3:179035183-179035205 CTATAAGGCCCTACATGTTCTGG + Intronic
968601966 4:1513683-1513705 CCCAGACCCCCTCCATGTTCTGG - Intergenic
968686294 4:1961362-1961384 CCCTGAGGCTCTGCTTGTCCGGG + Intronic
969141722 4:5080203-5080225 CTCTAAGGCCCTTTATGATCAGG + Intronic
970539737 4:17065464-17065486 CACTGACTCCATTCATGTTCAGG - Intergenic
974594911 4:64002026-64002048 CCCTGAGGCCCCACATGTTTGGG + Intergenic
975064512 4:70043506-70043528 CTCTGAGGCCCCACATGTTCAGG + Intergenic
975066012 4:70064328-70064350 CTCTGAGGCCCCACATGCTCAGG + Intergenic
977629599 4:99227300-99227322 CACTGAGGCCTGTCATGTGCGGG - Intergenic
983715873 4:170780642-170780664 TCCTTAGGTCCTCCATGTTCTGG - Intergenic
983917642 4:173309619-173309641 CTCTGATGCCCCTCATTTTCTGG + Intronic
985528260 5:418771-418793 TCATGAGGCCCTGCATCTTCTGG - Intronic
985641952 5:1067586-1067608 CCCTGAGGGCCTCCAAGTGCTGG + Intronic
986516421 5:8569241-8569263 AGCAGAGGCCCTTCAGGTTCAGG + Intergenic
986569933 5:9154385-9154407 CTCTGAGGCCATTCAACTTCAGG + Intronic
988923095 5:35962639-35962661 GCCTGAGGCCCCACATGTGCAGG - Intronic
988935799 5:36081824-36081846 TCCTGATCCCCTTAATGTTCTGG - Intergenic
995803243 5:116022835-116022857 ACATGAGGCCCTTAATGATCTGG + Intronic
997295005 5:132763610-132763632 CCCTGAGGACCATGGTGTTCAGG + Intronic
998238649 5:140422560-140422582 GGCTGAGGCACTTTATGTTCTGG + Intronic
999508521 5:152223560-152223582 GCATGAGGACCTGCATGTTCTGG + Intergenic
1001296832 5:170504366-170504388 CCCTGAGTCCCTGCATGTGCGGG + Intronic
1001819523 5:174699072-174699094 CCCTGAGCCCCTGCCTGTACTGG + Intergenic
1003914269 6:10771072-10771094 CCCAGAGGACATTCATGTTGTGG + Intronic
1006370984 6:33643415-33643437 CCCTAAGCCCCAACATGTTCAGG + Intronic
1006453367 6:34118225-34118247 CCCTTAGCCCCTTCCTGTTATGG - Intronic
1007103981 6:39270874-39270896 CCCAGAGGCCCTGCCTGTCCAGG + Intergenic
1007613693 6:43167568-43167590 TACAGAGGCCCTTCATGGTCTGG + Intergenic
1009858247 6:69291962-69291984 CTCTGTGACCCTTCATCTTCAGG - Intronic
1011170470 6:84499249-84499271 CCCTGAGGCAGTTCTTGCTCAGG - Intergenic
1011649391 6:89491857-89491879 CTCTGTGACCCTTCATCTTCAGG - Intronic
1018792284 6:167157706-167157728 CGCTGTGGACCTTCCTGTTCCGG - Exonic
1019382167 7:729461-729483 CCCTGAGCCTCTTCCTGTGCCGG + Intronic
1021150680 7:17147434-17147456 CCCAGAAGCCCTACATGGTCTGG + Intergenic
1021651712 7:22839392-22839414 CACTAAGGCCCTTAGTGTTCAGG - Intergenic
1022497659 7:30863116-30863138 CGCCGAGGGCCTTCCTGTTCTGG + Intronic
1022973728 7:35538731-35538753 CCCCGCGGCCCTTCCTGGTCTGG + Intergenic
1023837808 7:44078730-44078752 CCCTGCGCACCTTCATGGTCTGG + Intronic
1023869466 7:44255310-44255332 CCCAGAGGCCCTTCAGATTGTGG - Intronic
1033120451 7:138663294-138663316 CCCTGAGGCCCTTCATGTTCAGG + Intronic
1034139645 7:148803728-148803750 CCCTGAGGCATTTCTTTTTCAGG + Intergenic
1035388662 7:158490616-158490638 CCCTGGGGCCCTCCCGGTTCTGG - Intronic
1037448295 8:18990284-18990306 CCGTAAGGCCCTGCATGGTCTGG + Intronic
1040363004 8:46685062-46685084 CCCTGAAGCCATTCGAGTTCTGG + Intergenic
1042516310 8:69662940-69662962 TCCTGATGCCCTCCGTGTTCTGG + Intergenic
1044569278 8:93699940-93699962 CGCTCAGGCCCTTCAGGTCCGGG + Intronic
1045092083 8:98756444-98756466 TTTTGAGGCCCTTCATGGTCAGG - Intronic
1045490087 8:102661574-102661596 CACAAAGGCACTTCATGTTCTGG - Intergenic
1048469510 8:134695042-134695064 CCCTGAGGCCCATCAGTTTGCGG - Intronic
1049148152 8:141017197-141017219 CCCTGAGGCCCTTCTGAATCTGG + Intergenic
1053051919 9:34969125-34969147 CTGTGAGGCCCTGCATGGTCTGG - Intronic
1057199274 9:93131730-93131752 CCCTGTGGCCCTTCATGTGAGGG - Intronic
1057239759 9:93398631-93398653 CCCAGAGGCCCTTCATGACCCGG + Intergenic
1058700964 9:107599848-107599870 CACTGTGGCCCTTCCTGTCCTGG + Intergenic
1059344201 9:113617025-113617047 CCCTGGGGCCCTTCACCTTGTGG - Intergenic
1059447573 9:114348409-114348431 CCCTGAGGCCCTGCACCTTGTGG + Intronic
1059961089 9:119565090-119565112 TCCTGAAGACCTTCATGTGCTGG - Intergenic
1060483272 9:124030378-124030400 CCCTGAGGCCCTTTGTTTTATGG + Intronic
1061073264 9:128325177-128325199 CCCTGAGGACCTTCAGGGTGCGG - Exonic
1062322393 9:135996794-135996816 GGCTCAGGCCCTCCATGTTCTGG + Intergenic
1062521932 9:136961547-136961569 CCCTCAGGCCCTGCCTGATCCGG + Intergenic
1203636780 Un_KI270750v1:120089-120111 CTCTGAGGCCATCCATGGTCTGG - Intergenic
1185618660 X:1438937-1438959 CCCTTAGGCCCCTCATCTGCTGG + Intronic
1187921207 X:24203621-24203643 GCATGAGGCCCTTCATGACCTGG + Intronic
1189540572 X:41983503-41983525 CCCTATGGCCCTACATGATCTGG - Intergenic
1190569836 X:51769933-51769955 CTCTGAGGCCCCACGTGTTCAGG - Intergenic
1195751517 X:108164930-108164952 CCCTTAGGCCCTTTAGGTCCAGG + Exonic
1196154970 X:112418700-112418722 CTCTGAAGCTCTTAATGTTCTGG - Intergenic
1196409323 X:115399463-115399485 CAAAGAGGCCCTTCATGTTTAGG + Intergenic
1198107142 X:133472763-133472785 CCCACAGGCCCTTCAAATTCAGG - Intergenic
1198679588 X:139166920-139166942 ACATGAGACCCTTCATGATCTGG + Intronic
1198789392 X:140327127-140327149 CCACGAGGCCCTTCATGATCTGG - Intergenic
1198832834 X:140769275-140769297 CTATGAGGCCCTCCATGATCTGG - Intergenic
1199659821 X:150037821-150037843 CCATGTGGCCCTGCATGTTGTGG + Intergenic
1200091068 X:153636272-153636294 CCTTGGGGCCCTTGAGGTTCTGG + Intergenic
1201640186 Y:16169735-16169757 CCCAGAGGGCCTTCATCCTCTGG + Intergenic
1201662628 Y:16415590-16415612 CCCAGAGGGCCTTCATCCTCTGG - Intergenic
1202194469 Y:22284497-22284519 CCCCTAAGCCCTCCATGTTCTGG + Intergenic