ID: 1033125987

View in Genome Browser
Species Human (GRCh38)
Location 7:138707776-138707798
Sequence CCTCCAGGCCTCTCTGCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 371}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033125977_1033125987 -2 Left 1033125977 7:138707755-138707777 CCCTTCCCCTCCCCTTCATTTCC No data
Right 1033125987 7:138707776-138707798 CCTCCAGGCCTCTCTGCTTGTGG 0: 1
1: 0
2: 3
3: 43
4: 371
1033125979_1033125987 -7 Left 1033125979 7:138707760-138707782 CCCCTCCCCTTCATTTCCTCCAG No data
Right 1033125987 7:138707776-138707798 CCTCCAGGCCTCTCTGCTTGTGG 0: 1
1: 0
2: 3
3: 43
4: 371
1033125975_1033125987 3 Left 1033125975 7:138707750-138707772 CCTTCCCCTTCCCCTCCCCTTCA 0: 1
1: 59
2: 406
3: 1973
4: 7571
Right 1033125987 7:138707776-138707798 CCTCCAGGCCTCTCTGCTTGTGG 0: 1
1: 0
2: 3
3: 43
4: 371
1033125974_1033125987 6 Left 1033125974 7:138707747-138707769 CCACCTTCCCCTTCCCCTCCCCT No data
Right 1033125987 7:138707776-138707798 CCTCCAGGCCTCTCTGCTTGTGG 0: 1
1: 0
2: 3
3: 43
4: 371
1033125982_1033125987 -9 Left 1033125982 7:138707762-138707784 CCTCCCCTTCATTTCCTCCAGGC No data
Right 1033125987 7:138707776-138707798 CCTCCAGGCCTCTCTGCTTGTGG 0: 1
1: 0
2: 3
3: 43
4: 371
1033125980_1033125987 -8 Left 1033125980 7:138707761-138707783 CCCTCCCCTTCATTTCCTCCAGG No data
Right 1033125987 7:138707776-138707798 CCTCCAGGCCTCTCTGCTTGTGG 0: 1
1: 0
2: 3
3: 43
4: 371
1033125976_1033125987 -1 Left 1033125976 7:138707754-138707776 CCCCTTCCCCTCCCCTTCATTTC 0: 1
1: 1
2: 57
3: 444
4: 2154
Right 1033125987 7:138707776-138707798 CCTCCAGGCCTCTCTGCTTGTGG 0: 1
1: 0
2: 3
3: 43
4: 371
1033125972_1033125987 28 Left 1033125972 7:138707725-138707747 CCCTTCTCTCATCTGTCTCTTAC 0: 1
1: 0
2: 4
3: 90
4: 883
Right 1033125987 7:138707776-138707798 CCTCCAGGCCTCTCTGCTTGTGG 0: 1
1: 0
2: 3
3: 43
4: 371
1033125973_1033125987 27 Left 1033125973 7:138707726-138707748 CCTTCTCTCATCTGTCTCTTACC No data
Right 1033125987 7:138707776-138707798 CCTCCAGGCCTCTCTGCTTGTGG 0: 1
1: 0
2: 3
3: 43
4: 371
1033125978_1033125987 -3 Left 1033125978 7:138707756-138707778 CCTTCCCCTCCCCTTCATTTCCT 0: 2
1: 22
2: 194
3: 1294
4: 5788
Right 1033125987 7:138707776-138707798 CCTCCAGGCCTCTCTGCTTGTGG 0: 1
1: 0
2: 3
3: 43
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033125987 Original CRISPR CCTCCAGGCCTCTCTGCTTG TGG Intronic