ID: 1033129441

View in Genome Browser
Species Human (GRCh38)
Location 7:138733360-138733382
Sequence TCATGCCCACACAGAGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033129437_1033129441 9 Left 1033129437 7:138733328-138733350 CCACGGTCTAGAAGTAACGTCTA 0: 1
1: 0
2: 0
3: 2
4: 15
Right 1033129441 7:138733360-138733382 TCATGCCCACACAGAGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033129441 Original CRISPR TCATGCCCACACAGAGAGGG TGG Intronic
No off target data available for this crispr