ID: 1033129700

View in Genome Browser
Species Human (GRCh38)
Location 7:138735293-138735315
Sequence CTCAAGTACAGGTGGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 198}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033129700_1033129712 23 Left 1033129700 7:138735293-138735315 CCCTGTCCCCACCTGTACTTGAG 0: 1
1: 0
2: 1
3: 15
4: 198
Right 1033129712 7:138735339-138735361 TTTGCTCTGGGACATGTCAAAGG 0: 1
1: 0
2: 1
3: 14
4: 147
1033129700_1033129710 10 Left 1033129700 7:138735293-138735315 CCCTGTCCCCACCTGTACTTGAG 0: 1
1: 0
2: 1
3: 15
4: 198
Right 1033129710 7:138735326-138735348 AATTGTTTTCAGGTTTGCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 267
1033129700_1033129707 0 Left 1033129700 7:138735293-138735315 CCCTGTCCCCACCTGTACTTGAG 0: 1
1: 0
2: 1
3: 15
4: 198
Right 1033129707 7:138735316-138735338 GTACATCCCAAATTGTTTTCAGG No data
1033129700_1033129711 11 Left 1033129700 7:138735293-138735315 CCCTGTCCCCACCTGTACTTGAG 0: 1
1: 0
2: 1
3: 15
4: 198
Right 1033129711 7:138735327-138735349 ATTGTTTTCAGGTTTGCTCTGGG 0: 1
1: 0
2: 1
3: 34
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033129700 Original CRISPR CTCAAGTACAGGTGGGGACA GGG (reversed) Intronic
900522191 1:3111147-3111169 CCCAAGGCCAGGTGTGGACAGGG - Intronic
902581302 1:17409448-17409470 AGCAGGGACAGGTGGGGACATGG + Intronic
903547931 1:24138475-24138497 CACCAGTCCTGGTGGGGACATGG + Intronic
904153343 1:28461662-28461684 CTGAAGTTGAGGTGGGAACATGG + Intronic
904224800 1:29007527-29007549 ATCAAGTGCAGATGAGGACATGG - Intronic
908312794 1:62902255-62902277 CTCAAGTCCAGGTCTGGGCATGG - Intergenic
908650574 1:66328705-66328727 CACAAGTGCAGGTGGGAAAAAGG - Intronic
909377614 1:74957895-74957917 CTTAAGTTTAGGTGGGAACATGG + Intergenic
910267014 1:85348572-85348594 GAAAATTACAGGTGGGGACATGG - Intronic
914989217 1:152483903-152483925 CTCCAGTACATGATGGGACAAGG - Intergenic
915508426 1:156372025-156372047 CACAAGGACAGGTGAGGACCCGG - Intronic
917294640 1:173505895-173505917 CTCAAGTACAAGTAGGCACAGGG + Intronic
917852358 1:179076243-179076265 CTCAAGTCTGGGTGGTGACAAGG + Exonic
918365728 1:183805647-183805669 CTCAGGTTTAGCTGGGGACATGG + Intronic
918490953 1:185080929-185080951 CACAGTTACAGGTTGGGACATGG + Intronic
920055020 1:203185172-203185194 CTCAAGAACAGGTTGGGCCAGGG - Exonic
921133655 1:212241198-212241220 CTGAAGAAGAGGAGGGGACATGG - Intergenic
922932621 1:229402304-229402326 GGCAAGTACAGGAGGGAACAGGG + Intergenic
924565552 1:245195409-245195431 CACAAGGTCAGGTGGGAACAAGG - Intronic
1062863360 10:828013-828035 GTGAAGGGCAGGTGGGGACAGGG - Intronic
1064353414 10:14597563-14597585 CTGAGGAGCAGGTGGGGACAAGG + Intronic
1065311493 10:24420190-24420212 CTCAAGTACTGGTGAGGATGTGG - Intronic
1067243574 10:44517337-44517359 CTTAAGAACAGATGGGGACGGGG - Intergenic
1067819782 10:49518563-49518585 ATCAAGTGGAGGTGGGGGCAGGG - Intronic
1069934371 10:71905219-71905241 CTAAAATCCAGGTGTGGACAGGG - Intergenic
1069979886 10:72245061-72245083 CTTAACTACAGGTGGTGTCAGGG - Intergenic
1071495222 10:86163300-86163322 CTCAAGGACAGGATGGGCCATGG - Intronic
1071712682 10:88065010-88065032 CTCAATTTCAGGTGGGGGGAGGG + Intergenic
1075956599 10:126528702-126528724 CTCAGGTCCAGATGGGGTCAGGG - Intronic
1075975149 10:126688023-126688045 CTGAAGTTCCGGTGGGGTCAGGG - Intergenic
1076323870 10:129605413-129605435 ATGATGTACAGATGGGGACAGGG - Intronic
1076345094 10:129774243-129774265 CTCAGGTCCAGGTGAGTACATGG + Intergenic
1076857808 10:133126215-133126237 CTGAAGTACAGGTCGATACACGG + Intronic
1077195302 11:1276884-1276906 CCCAAGAACAGGTGTGGACGGGG + Exonic
1077197048 11:1286291-1286313 CTCAAATCCAGGAGGTGACATGG + Intronic
1081872283 11:46388765-46388787 CTCACGTGGAGGAGGGGACAGGG + Intergenic
1081963774 11:47157208-47157230 CACAAGTACAGGTGAGGAACGGG + Exonic
1083916551 11:65748367-65748389 ATCAAGTACTGGTGAAGACATGG - Intergenic
1084154192 11:67304461-67304483 CTCAAGTGCTGCTGGGAACATGG - Intronic
1085301428 11:75461152-75461174 ATCATGTACAGATGGGGAAATGG - Intronic
1088047239 11:105468897-105468919 CTGAAGTACTGGTGGGCAAAGGG - Intergenic
1090469133 11:126963910-126963932 GACAAGTGCAGGTGGGGAAATGG - Intronic
1090580563 11:128154150-128154172 CTCAAGTCCAGGATGGGAGATGG - Intergenic
1090975836 11:131679223-131679245 CTCAAGCACAGGGGAGGAGATGG - Intronic
1091672242 12:2460570-2460592 CTTAAGTGCAGATGGAGACAGGG - Intronic
1094051029 12:26220884-26220906 CTCAGGTAGAGGTAGGGATAGGG - Intronic
1098131055 12:67350523-67350545 ATGAAGTACAGGTGAGGACCTGG + Intergenic
1098906907 12:76171636-76171658 CGCAAATACAGGTGGGGAAGTGG + Intergenic
1100351748 12:93790304-93790326 CTCAACTATAGGTGGGGGGAGGG + Intronic
1101367516 12:104088915-104088937 ATCAAGAGCAGGTAGGGACAGGG - Intronic
1102580073 12:113880776-113880798 CTAAGGTACAGGTGGGAAAACGG - Intronic
1102991192 12:117317674-117317696 CTCAATTACATCTGGGAACAAGG - Intronic
1103470269 12:121174845-121174867 TGCAGGTACAGGTGGTGACATGG + Intronic
1104523041 12:129493065-129493087 TTCAAGTACAGCTGGATACAGGG - Intronic
1106358417 13:29006887-29006909 CTCAGGGACAGGTGGGGATGTGG + Intronic
1107407587 13:40129099-40129121 AGCAAGTACAGGTAGGGATATGG - Intergenic
1108694245 13:52888746-52888768 CTCAGCTAATGGTGGGGACATGG + Intergenic
1112948528 13:104961115-104961137 TTCAAGTACATGCAGGGACAAGG - Intergenic
1113275798 13:108728490-108728512 CTGAAGTCAAGGTGTGGACAGGG + Intronic
1114397909 14:22383725-22383747 CTCAGGTAAAGCTGGGGCCAAGG - Intergenic
1114493793 14:23119113-23119135 CTCAAGAGCAGGTGGGGGCGGGG - Exonic
1117341029 14:54791696-54791718 CTCAAAACAAGGTGGGGACAGGG - Exonic
1118785064 14:69038808-69038830 CTCATTTACAGATGGGGAAATGG - Intergenic
1121921183 14:97883127-97883149 GCCAAGTAACGGTGGGGACAAGG + Intergenic
1121935799 14:98017330-98017352 CTCAAGCCCAGGAGGAGACATGG + Intergenic
1122881835 14:104693771-104693793 CCCAGGTACAGATGGGGAGATGG - Intronic
1123090158 14:105738833-105738855 ATCAGGGACAGGTGGGGACATGG + Intergenic
1123482153 15:20641925-20641947 CTGGAGGACAGGTGTGGACAGGG - Intergenic
1127292734 15:57584915-57584937 CTCAAGCTCATGTGGGGAAAGGG - Intergenic
1129274437 15:74435748-74435770 CTGAGGTACAGGGAGGGACAAGG + Intergenic
1129565336 15:76615969-76615991 AACAAGTACTGGTGAGGACATGG + Intronic
1132743616 16:1427884-1427906 CTCCGGGACAGGTGGGGTCACGG + Intergenic
1132762389 16:1516321-1516343 GACAAATACAGGTGGGGACACGG + Intronic
1132771214 16:1564558-1564580 CACAGGGACCGGTGGGGACAAGG - Intronic
1135394031 16:22117289-22117311 ATTGAATACAGGTGGGGACAAGG - Intronic
1138121190 16:54402145-54402167 GTCAAGTAAAGGTGGGGACCTGG + Intergenic
1139814180 16:69653992-69654014 CTCAAGTACAGGAGGAAAGAAGG + Intronic
1141525073 16:84605742-84605764 CTAAAATCCAGGTGTGGACAGGG - Intronic
1142894151 17:2963737-2963759 CTCAAGTACCAGTGGGTACCAGG + Intronic
1143950888 17:10631445-10631467 CTAAAGTGCAGGAGGGAACAGGG + Intronic
1144653041 17:17019016-17019038 TTCCAGTTCAGCTGGGGACATGG + Intergenic
1145293145 17:21565809-21565831 CTCAAGTCCAGATGTGGACTTGG + Intronic
1145386823 17:22420117-22420139 CTCAAGTCCAGATGTGGACTTGG - Intergenic
1146286485 17:31577558-31577580 GTGAAGGACAGGTGGGGAGATGG + Intergenic
1147436858 17:40421631-40421653 TTCAAGTACAGGTTGGGGGAGGG - Intergenic
1151824033 17:76513597-76513619 CTCAAGTCAAGGTGGGGGCCGGG - Intergenic
1152307342 17:79529025-79529047 CTCAGGTAGAGGTGGGGACATGG + Intergenic
1152308971 17:79537752-79537774 CTCAATTTGAGGTGGGGAGATGG - Intergenic
1152534705 17:80943712-80943734 CAGAAGTTCAGGTGAGGACACGG + Intronic
1152827244 17:82474847-82474869 CTCAGCTCCAGATGGGGACAGGG + Intronic
1153435180 18:5061394-5061416 CTCAAGTCAAGGTGTCGACAGGG + Intergenic
1154191030 18:12231284-12231306 CTCAGGTAGGGGTGGGGACTGGG + Intergenic
1155235320 18:23812629-23812651 CTTTAGTACGGGTGGGAACAAGG + Intronic
1155363740 18:25030081-25030103 CTCACTTACAGGTGAGAACATGG - Intergenic
1157529156 18:48407750-48407772 CTCATGTACTTGTGGGGGCAGGG + Intronic
1157894637 18:51453987-51454009 CCCAGATACAAGTGGGGACATGG + Intergenic
1158888183 18:61848759-61848781 CTGATGTACAGATGGGGACAAGG + Intronic
1160077730 18:75694060-75694082 CTCAAGCACAGATGGGAAAAGGG + Intergenic
1160165459 18:76507371-76507393 CTCACGGACAGGTGGAGAAAGGG + Intergenic
1160259230 18:77275462-77275484 GTCAAATATAGGTGGGGACTTGG + Exonic
1161234449 19:3190918-3190940 CCCACGTTCAGCTGGGGACACGG - Intronic
1165395378 19:35560922-35560944 GCCAGGTACAGCTGGGGACAGGG + Exonic
1165602982 19:37073831-37073853 CTCAAAGACAAATGGGGACACGG + Intronic
1165904367 19:39184647-39184669 CTGAAGTGCAGGTGTGGACAGGG - Intergenic
1166239515 19:41480447-41480469 GCCAGGCACAGGTGGGGACAAGG - Intergenic
1166539413 19:43595436-43595458 CTCAAGAACCGAAGGGGACAGGG - Intronic
1167809581 19:51816676-51816698 CAGAAGTACAGGTGGCCACATGG + Intronic
926218082 2:10917573-10917595 CTGTTGTACAGATGGGGACATGG + Intergenic
928132807 2:28665350-28665372 CTCAAACTCCGGTGGGGACAGGG + Intergenic
928567948 2:32572721-32572743 CTCAAGTATATGTGGAAACAAGG + Intronic
929390539 2:41464185-41464207 GTCAAGTATAGGTGGGGATGTGG - Intergenic
931062681 2:58548579-58548601 CTAAAGTAAAGATGGGGAGAAGG - Intergenic
931951435 2:67367664-67367686 ATCAAGTGTAGGTGAGGACAGGG - Intergenic
932893415 2:75615395-75615417 GTCAAGTAGACCTGGGGACAAGG - Intergenic
932968704 2:76511193-76511215 CTCAAGAGCAGGTGGGGACTGGG + Intergenic
934077417 2:88439953-88439975 CTCAAGTATAGGAGGACACAGGG + Intergenic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
935060414 2:99602189-99602211 CTCAACTACAGGTGGGAAAAGGG - Intronic
935525572 2:104162723-104162745 ATCAAGTACTGCTGGGGAGAGGG - Intergenic
938128353 2:128690572-128690594 CACAGGGACAGGTGGGGACGGGG - Intergenic
938528693 2:132162137-132162159 CTCAGGTTGAGGAGGGGACAGGG - Intronic
939275645 2:139993125-139993147 CTCAAGCACACGTGGGGTCCTGG - Intergenic
939771379 2:146323874-146323896 CTCAAATACATCTGGGAACAAGG - Intergenic
942430454 2:175905894-175905916 CTCAATTACAAGTGAGAACATGG + Intergenic
947637003 2:231685247-231685269 CTCAAGCACAGGTTGGAACCAGG - Intergenic
948591908 2:239055867-239055889 CTCCAGGACACCTGGGGACATGG - Intronic
948953472 2:241270545-241270567 CAGAATTTCAGGTGGGGACAGGG - Intronic
948989056 2:241542530-241542552 CCCAAGTCCAGGCGGGCACAGGG - Intergenic
1169804750 20:9547933-9547955 CACATGAACAGGTGGGGATAAGG + Intronic
1170872607 20:20220479-20220501 CAGAAGTACAGGTGGCAACATGG + Intronic
1172190735 20:33060442-33060464 CACATATACAGATGGGGACATGG - Intronic
1172467402 20:35166436-35166458 CTGAAGTCCAGCTGGGCACACGG + Intergenic
1176256936 20:64157935-64157957 GACAGGGACAGGTGGGGACAGGG - Intronic
1176256996 20:64158089-64158111 GACAGGAACAGGTGGGGACAGGG - Intronic
1176257057 20:64158278-64158300 GACAAAGACAGGTGGGGACAGGG - Intronic
1179876530 21:44271750-44271772 GCCAGGAACAGGTGGGGACATGG + Intergenic
1180160474 21:45996869-45996891 CTCAGGTGCAGGTGGGGGCAGGG + Intronic
1181828717 22:25541388-25541410 CCCAGGTAGAGGTGGGAACATGG - Intergenic
949658180 3:6246023-6246045 CTCAAGTGCTGGTGGGGAAGAGG - Intergenic
951168261 3:19507620-19507642 GACATGTTCAGGTGGGGACAGGG + Intronic
951426441 3:22551814-22551836 ATAAAGTACAAGTGAGGACATGG + Intergenic
954447166 3:50553000-50553022 CTCAAGTCCAAGTGGGGACTAGG + Intergenic
956719457 3:72105172-72105194 GTCAAGTAGAGGTGGTGATATGG - Intergenic
957979520 3:87490831-87490853 TTCAACTAAAGGTGGGTACATGG - Intergenic
959683444 3:109121781-109121803 CTGAAGCACAGGAAGGGACAAGG + Intergenic
960564173 3:119116822-119116844 ATCAGGTCCAGGTGGAGACATGG - Intronic
961609603 3:128126121-128126143 GGCCAGTACGGGTGGGGACAGGG + Intronic
962181832 3:133214304-133214326 CTGCTTTACAGGTGGGGACATGG - Intronic
962312634 3:134337187-134337209 CGCAAGTACAGGTGAGGGCAGGG + Intergenic
967862137 3:194160275-194160297 CTCAAGTACATTTGGGTGCATGG + Intergenic
968134199 3:196209596-196209618 CACAAGGAAGGGTGGGGACAAGG + Intronic
968601224 4:1510541-1510563 GCCAAGTGCAGGTGAGGACACGG - Intergenic
970445654 4:16121349-16121371 CTCAACTCAGGGTGGGGACATGG + Intergenic
976424368 4:84883700-84883722 CTCAACTAGAGCTGGGGAAAAGG + Intronic
979520195 4:121657080-121657102 CTAAAGTAAAGGTGTGGGCAGGG - Intergenic
983671824 4:170246606-170246628 CTCAACTACTGATGGGGACAGGG + Intergenic
984864705 4:184271777-184271799 GTGAAATGCAGGTGGGGACAAGG + Intergenic
985018475 4:185661900-185661922 CTCAGACACAGGTGGAGACATGG + Intronic
985655131 5:1127489-1127511 CTGAAGTCCAGGTGTGGGCAGGG - Intergenic
987190115 5:15468920-15468942 TTCAATTACAGGTGAGGATAGGG - Intergenic
992739774 5:79762124-79762146 CTCATGCTCAGGTGGGGAGATGG + Intronic
999130476 5:149279146-149279168 CTAAAGTTGAAGTGGGGACATGG + Intronic
1002003164 5:176210026-176210048 CTGAGATTCAGGTGGGGACATGG + Intergenic
1002223291 5:177700924-177700946 CTGAGATTCAGGTGGGGACATGG - Intergenic
1006518925 6:34560338-34560360 CGCAAGGACTGGAGGGGACAGGG - Intergenic
1007386516 6:41523734-41523756 CTTCAGGGCAGGTGGGGACAAGG - Intergenic
1007955625 6:45915409-45915431 CCCAAGAAGAGTTGGGGACAAGG + Intronic
1008095358 6:47334352-47334374 CACAAGTATAGGAGGGGTCAGGG - Intergenic
1008822454 6:55650531-55650553 CTCCAGTACTGGTGGCCACAAGG - Intergenic
1012604741 6:101144166-101144188 CTGAAGTACAGTTGGAGACTTGG + Intergenic
1015366760 6:132403926-132403948 CTCAATTACATCTGGGGCCAAGG - Intergenic
1016990242 6:149923452-149923474 CGCAGGTACAGGCGAGGACAGGG - Intergenic
1017649861 6:156570869-156570891 CCCAGGAAAAGGTGGGGACAGGG + Intergenic
1018472760 6:164111371-164111393 CTTGAGGATAGGTGGGGACAAGG - Intergenic
1019390779 7:785680-785702 CTCTGGCTCAGGTGGGGACAAGG - Exonic
1019625268 7:2012714-2012736 CTCACCCATAGGTGGGGACACGG + Intronic
1024721205 7:52139165-52139187 CCCAAGTACAGCTTGGGCCATGG - Intergenic
1025249014 7:57339326-57339348 CACAAGGACAGCTGGGCACAGGG + Intergenic
1026481945 7:70786970-70786992 CAAAAGCAAAGGTGGGGACAGGG - Intronic
1027474112 7:78608313-78608335 CTCAAAGCCAGTTGGGGACAGGG - Intronic
1029594480 7:101529969-101529991 CTCTAATACTGGTGGGGAGAGGG - Intronic
1030148637 7:106380971-106380993 CTCTAGTATATCTGGGGACAAGG - Intergenic
1030386373 7:108872369-108872391 CTTAAGTCCAGGTGTTGACAAGG + Intergenic
1030456728 7:109783935-109783957 CTCATTTACTGGTGGGGGCAGGG - Intergenic
1032299770 7:130675937-130675959 CTCAACTAGGAGTGGGGACACGG + Intronic
1033129700 7:138735293-138735315 CTCAAGTACAGGTGGGGACAGGG - Intronic
1034292185 7:149941642-149941664 ATCATATGCAGGTGGGGACAAGG + Intergenic
1036814268 8:11889396-11889418 CCCAACAACATGTGGGGACACGG + Intergenic
1041916675 8:63145821-63145843 CTAAAGTAAGGGTGGGGGCATGG + Intergenic
1046086890 8:109448332-109448354 CTCAAATACAACTGTGGACATGG - Exonic
1047342344 8:123994270-123994292 CTCAAAGACAGGTGGGGTCTGGG + Intronic
1047953276 8:129953362-129953384 CTCAAGTACAAGTTGGGACCAGG - Intronic
1048792011 8:138112831-138112853 CTCAAGTGGGGGTGGAGACAGGG + Intergenic
1049288472 8:141789253-141789275 CTCATGCACAGGTGGGGCCTGGG + Intergenic
1049649761 8:143760232-143760254 GTCAACCACAGGTGAGGACAAGG + Intergenic
1049656683 8:143802180-143802202 CTCAAGGACAGGAGGGGACCCGG + Intronic
1053180376 9:35962915-35962937 CCCAATTAGAGGTGGTGACAGGG + Intergenic
1054812615 9:69446882-69446904 CTTAAGTAAAGGTGGGGATGGGG - Intronic
1056546518 9:87618280-87618302 CTCAAGTGTTGGTGGGGATATGG + Intronic
1057753495 9:97810730-97810752 CTCAGGGGCAGGTGGTGACAAGG + Intergenic
1061136893 9:128739919-128739941 ATCAATTACAGGTGTGGGCAGGG - Exonic
1062058232 9:134480275-134480297 CAGAAGCACAGGTGGGGCCACGG - Intergenic
1187434273 X:19252876-19252898 CTCAAGCAAAGGTGTGAACAAGG - Intergenic
1190691938 X:52919729-52919751 CTGAAGGACATGTGGGGAGAGGG + Intergenic
1190694045 X:52936063-52936085 CTGAAGGACATGTGGGGAGAGGG - Intronic
1192795321 X:74420974-74420996 CTCAAGTCCAAGGAGGGACATGG + Intergenic
1192841915 X:74865742-74865764 CTAAAGTACAGCTTGGGCCATGG + Intronic
1194600852 X:95919706-95919728 CTCAAGTACCACCGGGGACAAGG - Intergenic
1195969435 X:110457664-110457686 CTGTAACACAGGTGGGGACAGGG - Intergenic
1196228169 X:113189960-113189982 CTCAAGCACACGTGGAGACTGGG - Intergenic
1196604256 X:117638009-117638031 CTCAAGCACAGCTGTGGAGATGG - Intergenic
1196894021 X:120315816-120315838 CTGAAGTTCAGTTGGGCACAAGG + Intergenic
1197534233 X:127667118-127667140 CCAAAGTACAGGTTGGGCCATGG + Intergenic
1197721849 X:129750668-129750690 CTCAAGAATTGGTGGGCACATGG - Intronic
1200165150 X:154030652-154030674 CTCAGGTGGAGGTGGGGGCAGGG + Exonic