ID: 1033138143

View in Genome Browser
Species Human (GRCh38)
Location 7:138801667-138801689
Sequence AAATGCTTGAAGAAGTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 264}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033138137_1033138143 9 Left 1033138137 7:138801635-138801657 CCCAGGTCAGCAGCTAACAATGC 0: 1
1: 0
2: 2
3: 10
4: 116
Right 1033138143 7:138801667-138801689 AAATGCTTGAAGAAGTTTGGAGG 0: 1
1: 0
2: 0
3: 27
4: 264
1033138136_1033138143 13 Left 1033138136 7:138801631-138801653 CCATCCCAGGTCAGCAGCTAACA 0: 1
1: 0
2: 1
3: 13
4: 183
Right 1033138143 7:138801667-138801689 AAATGCTTGAAGAAGTTTGGAGG 0: 1
1: 0
2: 0
3: 27
4: 264
1033138138_1033138143 8 Left 1033138138 7:138801636-138801658 CCAGGTCAGCAGCTAACAATGCC 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1033138143 7:138801667-138801689 AAATGCTTGAAGAAGTTTGGAGG 0: 1
1: 0
2: 0
3: 27
4: 264
1033138135_1033138143 14 Left 1033138135 7:138801630-138801652 CCCATCCCAGGTCAGCAGCTAAC 0: 1
1: 0
2: 1
3: 12
4: 141
Right 1033138143 7:138801667-138801689 AAATGCTTGAAGAAGTTTGGAGG 0: 1
1: 0
2: 0
3: 27
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033138143 Original CRISPR AAATGCTTGAAGAAGTTTGG AGG Intronic
905132887 1:35774665-35774687 AAAGGCTTAAGAAAGTTTGGAGG + Intergenic
905991443 1:42340606-42340628 CAATGCTAGATGGAGTTTGGTGG + Intergenic
906918644 1:50039299-50039321 ACATACTTGAAGTAGTATGGTGG - Intergenic
907339322 1:53723323-53723345 AATTGCTTGAAGAACATGGGAGG - Intronic
908438286 1:64128482-64128504 AAATGCATGGAGAGGTTGGGTGG + Intronic
908622583 1:66000966-66000988 ATATGCTTGGAGAATTTTGGAGG + Intronic
909792252 1:79694161-79694183 AGAGGCTGGAAGAAGTTAGGGGG - Intergenic
909804234 1:79854851-79854873 AAAAGCTTCTAGAAGTTTAGAGG - Intergenic
909808602 1:79904046-79904068 ATATGAATGAAGAAGATTGGTGG + Intergenic
910332560 1:86091453-86091475 AAATCCCTGAACAATTTTGGTGG - Intronic
910755192 1:90682396-90682418 AAAAGATTGAAGAGCTTTGGTGG + Intergenic
911048955 1:93653537-93653559 AGATGCTTGATGATGTTTGTGGG - Intronic
911618053 1:100036893-100036915 AAAGGCTTGACCAAGGTTGGAGG + Intergenic
913104519 1:115599939-115599961 AAATGCTAGAAGAAGTTATTTGG + Intergenic
913126433 1:115794715-115794737 AAATACTTGCAGAAGTTTCAGGG + Intergenic
913195265 1:116451091-116451113 AGATGATTTTAGAAGTTTGGGGG - Intergenic
915821822 1:159031845-159031867 AAATATTTGAAGAAATTAGGAGG + Intronic
916955486 1:169828880-169828902 AAATGGTTGAAGAAACTTAGAGG - Intronic
917185397 1:172348550-172348572 AAATGTGTGAAAAATTTTGGTGG - Intronic
922457065 1:225783175-225783197 AAATGCCTTTAGATGTTTGGGGG + Intronic
924525485 1:244844054-244844076 AAATGCTTAAAGAAATATTGGGG + Exonic
1063716207 10:8529538-8529560 AAATGAGTGAACAACTTTGGTGG - Intergenic
1065025926 10:21539178-21539200 GAAAGCTTGAAGAAGTTTGAAGG + Intronic
1065530755 10:26667757-26667779 AAAACCTTTAAGAAGTTTGCTGG + Intergenic
1066291043 10:34014651-34014673 AAATGCTTGAGGAGTTTTTGAGG - Intergenic
1068042748 10:51846745-51846767 AATTGCTTGAAGATGTTTTGAGG + Intronic
1068108937 10:52655470-52655492 AAATGCTTTAGGAAGACTGGTGG + Intergenic
1070438436 10:76416412-76416434 AAAAGCTTAAAGAAGTTAGATGG - Intronic
1070912043 10:80127240-80127262 TAAGGCTTGGAGAAGTTAGGAGG - Intergenic
1070919026 10:80172468-80172490 AAATCCTTGAAGCAATTTTGCGG + Intronic
1071379321 10:85042355-85042377 AAACACATGAAGAAGTTAGGAGG + Intergenic
1071929159 10:90446452-90446474 AAATGCTTAAACACTTTTGGTGG - Intergenic
1072712253 10:97723482-97723504 AAATCCTTGAAGCAGCATGGTGG - Intergenic
1072773843 10:98168906-98168928 AAATGCTTGGAGGAGTTGGTAGG + Intronic
1074381684 10:112985791-112985813 AAATGCTGGTAGAAGTTGGGAGG + Intronic
1074626129 10:115188572-115188594 TCATGCTTTAAGAATTTTGGAGG + Intronic
1076474257 10:130741510-130741532 AAATGCCTAGAGAAGCTTGGCGG + Intergenic
1077495013 11:2882766-2882788 CAAGGCCTGAAGAAGTCTGGAGG + Intergenic
1078279704 11:9888646-9888668 AAATGCCTGAAGAAATTAGAGGG + Intronic
1078407716 11:11085844-11085866 AAATGCTAGTAGAAGATTGCTGG + Intergenic
1079415514 11:20232243-20232265 AAATGTTTTAAGAAGTGGGGGGG - Intergenic
1080114184 11:28603557-28603579 AAATGCCTGTAGAAGTGTCGTGG + Intergenic
1080144676 11:28967278-28967300 AAATGCTTGAGTAAGTCTGCTGG - Intergenic
1080730526 11:34947141-34947163 AAATGTTTGAAAAAGTAAGGGGG + Intronic
1084142892 11:67245390-67245412 AGAGACATGAAGAAGTTTGGGGG + Exonic
1085798177 11:79563026-79563048 AAATGGAAGAAGAATTTTGGAGG - Intergenic
1086152707 11:83630061-83630083 AAGTGCTTGAAGTACTTTAGTGG - Intronic
1089030207 11:115318706-115318728 AAATCCATGAAGAATTTTGCAGG + Intronic
1090329185 11:125916952-125916974 AAGTGCTTGAAGAAGAGTGATGG + Intronic
1094106638 12:26819280-26819302 AAATTCTTGAAGAAATTGGCTGG + Intronic
1095668284 12:44828407-44828429 AAATTTTTGAAGGTGTTTGGGGG - Intronic
1096958995 12:55558914-55558936 AAAGGCTTGAAGAGGATAGGAGG + Intergenic
1098840440 12:75471240-75471262 AATTGCTTAAAGAAGTTTGTGGG + Intergenic
1099021453 12:77410025-77410047 ATATGCTTGGAGAAATTTGGGGG - Intergenic
1099710478 12:86217880-86217902 AGAAGGTTGTAGAAGTTTGGTGG + Intronic
1099821591 12:87718016-87718038 TAATAATAGAAGAAGTTTGGTGG + Intergenic
1100527700 12:95435289-95435311 AGATGCTTGAAGAAGTCTGTTGG - Intergenic
1101490959 12:105208973-105208995 AAAAGCTGGAGGCAGTTTGGAGG - Intronic
1102074170 12:110046874-110046896 AAACACTGTAAGAAGTTTGGTGG - Intronic
1102563768 12:113781120-113781142 AAATCCTGGGAGAAGTTTTGAGG - Intergenic
1107183713 13:37492890-37492912 AAATGCTTTCACAGGTTTGGTGG + Intergenic
1107635956 13:42392807-42392829 AGGTGCTTGATGAATTTTGGTGG + Intergenic
1108725584 13:53176868-53176890 AAATGTTAGAAGTATTTTGGGGG + Intergenic
1109207849 13:59501432-59501454 AATTCCAGGAAGAAGTTTGGAGG - Intergenic
1111354917 13:87086565-87086587 AATTGCTGGAAGCAGTTAGGTGG + Intergenic
1111747938 13:92293191-92293213 TAATTCTTGAAGAATGTTGGTGG + Intronic
1112198069 13:97245264-97245286 ACTTGCTTGAAGAAGTTTTTGGG + Intronic
1112265665 13:97921114-97921136 AGATGCTGGAGGCAGTTTGGAGG - Intergenic
1112358880 13:98698526-98698548 AAATGCTTGAACATTTGTGGAGG - Intronic
1112477074 13:99741256-99741278 AAATTCTCTAGGAAGTTTGGTGG + Intronic
1113098276 13:106689467-106689489 AAATGCTTGCAGGACTATGGTGG + Intergenic
1114140142 14:19900550-19900572 CAAAGTTTGAAAAAGTTTGGAGG + Intergenic
1114928205 14:27431978-27432000 AAATGCTTGGAAAACTATGGGGG + Intergenic
1115590284 14:34857695-34857717 AAATCCTGGAACCAGTTTGGAGG - Intronic
1115853553 14:37606132-37606154 AGGTGCTTGAAGAAGTCTGGAGG + Intronic
1117254685 14:53965623-53965645 AAATGCTAAAAGAAAGTTGGTGG - Intergenic
1117590700 14:57265334-57265356 AGATTCTTGAAGAATTATGGGGG + Intronic
1117979364 14:61327289-61327311 AAAATCTGGAAGAATTTTGGTGG - Intronic
1118169836 14:63377836-63377858 AAAAGCCAGAAGAAGATTGGAGG - Intronic
1118861755 14:69669624-69669646 ATAAGCTTGAAGATGTTTAGGGG - Intronic
1120355691 14:83430298-83430320 AAATGCTTGATAAATTTTAGTGG - Intergenic
1121558067 14:94853575-94853597 AAATGCTTGATGAAAGTTGGTGG + Intergenic
1124899161 15:33806535-33806557 AAATGCTTTTAAAAATTTGGTGG - Intronic
1125130879 15:36282804-36282826 AAATTCTTCAAGAAGTTTTTAGG + Intergenic
1126302616 15:47215818-47215840 AAATGCTTGAAGAATGTTTGTGG + Intronic
1129700608 15:77765932-77765954 AAATGCTTGACGATGTTCAGTGG - Intronic
1130911019 15:88270810-88270832 AATTGCTTGGAGAAATTGGGGGG - Intergenic
1131224822 15:90615792-90615814 AAATGCTGGGAAAAGTTTGAAGG - Intronic
1132918209 16:2366490-2366512 AAATGCTTGAAAAACATTGTTGG - Intergenic
1134427600 16:14166386-14166408 AAATGCATGAATAATTTTGATGG - Intronic
1134616171 16:15652544-15652566 AAATGTTTGAAAAGGGTTGGAGG + Intronic
1135046388 16:19159414-19159436 AAATTCTTGAACCAGTGTGGAGG + Intronic
1136030244 16:27497466-27497488 AGATGCTGGAAGAAGTTATGCGG + Intronic
1138237480 16:55396995-55397017 AAATGCTTGCTGAGGTTAGGTGG - Intronic
1140041894 16:71413599-71413621 AAATGGTGGCAGGAGTTTGGTGG + Intergenic
1141300675 16:82812687-82812709 ACATCTTTTAAGAAGTTTGGCGG + Intronic
1142965236 17:3576923-3576945 AAATGCTTTAAGAATTTTCCAGG - Intronic
1144500809 17:15785963-15785985 AGATGCTTGAGGTAGTTTGGGGG - Intergenic
1145162971 17:20588633-20588655 AGATGCTTGAGATAGTTTGGGGG - Intergenic
1145352122 17:22092009-22092031 AAAATGATGAAGAAGTTTGGGGG + Intergenic
1145722576 17:27087955-27087977 AAAATGGTGAAGAAGTTTGGGGG - Intergenic
1146634111 17:34491492-34491514 CAAAGCCTGAAGATGTTTGGTGG - Intergenic
1148359884 17:47003071-47003093 AAATATTTGTAGAAGTTGGGGGG - Intronic
1148968794 17:51461502-51461524 AAATACTAGAGGAAGATTGGTGG + Intergenic
1149959200 17:61088894-61088916 ACATGCCTGAGGAAGTGTGGTGG + Intronic
1153229370 18:2921732-2921754 AAAGGGTTGAAGAAATTGGGTGG - Intronic
1154081008 18:11256854-11256876 AAGTGCTAGAAGCACTTTGGGGG + Intergenic
1156300965 18:35835581-35835603 AAATTCTTGAACAAGTTTTGGGG + Intergenic
1156609341 18:38708028-38708050 AAATGGTTGCTGAACTTTGGTGG - Intergenic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
925086456 2:1111656-1111678 AAATTCTTGAAGTAATTTGAAGG - Intronic
925958479 2:8993230-8993252 AAAGCATTGAAGAATTTTGGGGG - Intronic
926343865 2:11927751-11927773 GAATGCTTGGAGAAGATTGGAGG + Intergenic
926708893 2:15859477-15859499 AAATGCATAAAGCAGTGTGGTGG + Intergenic
926743008 2:16127669-16127691 TAATGCTTGAAGAAGTGAAGTGG + Intergenic
926787697 2:16534562-16534584 AACTGATTGAAGTAGTGTGGTGG - Intergenic
927343606 2:22010504-22010526 TATTTCTTGAAGAAGATTGGAGG - Intergenic
927655011 2:24937909-24937931 AAATGCCTGACCACGTTTGGGGG + Intergenic
928301861 2:30132157-30132179 AAATACTTGCAGAAGATTGCAGG - Intergenic
928801092 2:35093248-35093270 ACATTCTTGAAGAAGTAAGGTGG + Intergenic
931360773 2:61575903-61575925 AAAAGCTAGAAGAAGTTTCTAGG + Intergenic
931791615 2:65668649-65668671 AATTGCTTGAAGAGGGTTTGGGG - Intergenic
932982147 2:76682014-76682036 AATTGCTTGAAGCAGGTAGGTGG - Intergenic
935330381 2:101973319-101973341 ACATGCTTCAGGGAGTTTGGTGG + Intergenic
935451996 2:103220524-103220546 AACAGATTGAAGAAATTTGGAGG - Intergenic
935723959 2:106007005-106007027 CAGAGCTTGAAGCAGTTTGGAGG + Intergenic
936770018 2:115901023-115901045 CAATACTTGAAGAAATTTTGAGG + Intergenic
937846644 2:126585726-126585748 AAATGCGTGAAGACTTTGGGGGG + Intergenic
938840629 2:135158964-135158986 AAAAATTTGCAGAAGTTTGGGGG + Intronic
941163782 2:162063758-162063780 AAACTCTTTAAGAAGTTTTGTGG + Intronic
941184238 2:162301437-162301459 CAATGATTAAAGAAGTTTGGGGG + Intronic
942310888 2:174655626-174655648 AGATGGTTGAAGAAGGTTGCTGG - Intronic
944111427 2:196135392-196135414 AAATTCTTTAAGTAGTTTGTTGG - Exonic
945086626 2:206138512-206138534 AATGTCTTGAAGAATTTTGGGGG + Exonic
945310397 2:208305429-208305451 AGATGCTTGAACTAGATTGGGGG + Intronic
945494235 2:210490569-210490591 GAATACTTGTAGAAGTTTGTGGG + Intronic
947705572 2:232272923-232272945 AAATGCTTCTAGAAGTGGGGTGG - Intronic
1169022105 20:2337781-2337803 TAATGCTGGAAGAAGGTTTGAGG - Intronic
1169570254 20:6898469-6898491 AAATGTTGGAATAAGTTTAGTGG + Intergenic
1169768965 20:9180867-9180889 AAATGCTTAAATAATTTTGTAGG - Intronic
1170194705 20:13677893-13677915 AACTGCTACCAGAAGTTTGGAGG - Intergenic
1170560313 20:17551595-17551617 AAATACATGAATAAGATTGGTGG - Intronic
1170711036 20:18791265-18791287 AAATGCTCTAAGGAGCTTGGAGG - Intergenic
1172075390 20:32292423-32292445 AATTGTTTGTAGAAGTTGGGGGG - Intronic
1173052282 20:39575131-39575153 AAAAGCTTGAAGAAGCTGGAGGG - Intergenic
1173303216 20:41822780-41822802 AGCTGCTTGAAGAAGTTTCCAGG + Intergenic
1174895515 20:54445619-54445641 ATATGCTTCAAGAGGTTGGGGGG - Intergenic
1174918067 20:54674033-54674055 AATTGCTTTAAGAAATCTGGTGG + Intergenic
1176648886 21:9528350-9528372 AAAATGATGAAGAAGTTTGGGGG - Intergenic
1177371061 21:20204267-20204289 AAATGTTTAAAGAAGTATGAAGG - Intergenic
1177585497 21:23088930-23088952 AGTTCCTTAAAGAAGTTTGGTGG + Intergenic
1178736842 21:35160253-35160275 AAATGCTATAAGAAATTAGGAGG + Intronic
1179190317 21:39117434-39117456 AAATGCATGAAGACTTTGGGTGG + Intergenic
1179605986 21:42515297-42515319 AAATGCATGAAAACTTTTGGAGG + Intronic
1180919472 22:19513481-19513503 AACAGCTGGAAGGAGTTTGGAGG - Intronic
1183592789 22:38790314-38790336 AAATACTTGAAGGAGAGTGGTGG + Intronic
1184589124 22:45469689-45469711 AAAGGCATGAAAAAATTTGGAGG - Intergenic
949283527 3:2374337-2374359 AACTGCATGAAGAAGCATGGAGG - Intronic
949401558 3:3670064-3670086 ACATGCTTGAAGAAATATGTGGG - Intergenic
951311500 3:21131372-21131394 AAATGCTTGATGTATTTTTGAGG + Intergenic
951359648 3:21710158-21710180 AAAGACATGAAGGAGTTTGGGGG + Intronic
951797757 3:26560136-26560158 TAATACTTGAAGAAATCTGGAGG - Intergenic
956312220 3:67893918-67893940 AAATACTTCAAGAAGATTGATGG - Intergenic
957043248 3:75353316-75353338 GAATGCTTGAACATGATTGGAGG - Intergenic
958459378 3:94375063-94375085 GAAGGCTTGAGGCAGTTTGGTGG + Intergenic
958830196 3:99078022-99078044 ATATGCATGAAGAAATTTGGGGG - Intergenic
960076255 3:113489359-113489381 AACTCTTTCAAGAAGTTTGGTGG - Intronic
961396614 3:126597401-126597423 AAATGTTTGAAAAAATTTGACGG + Intronic
963040874 3:141068950-141068972 AGGTGGTTGAACAAGTTTGGTGG + Intronic
963190618 3:142467983-142468005 AAATCCTTAGAGAAGTTTGTTGG - Exonic
964291724 3:155188552-155188574 AAATGCTTATAGACATTTGGAGG - Intergenic
967634916 3:191790286-191790308 AAATGAGTTAAGAATTTTGGGGG - Intergenic
969018639 4:4123113-4123135 GAATGCTCGAATATGTTTGGAGG - Intergenic
970221013 4:13811090-13811112 AAATGGGTGAAGAGCTTTGGAGG - Intergenic
972785336 4:42321298-42321320 ATACGCTTAAAGAAGGTTGGAGG - Intergenic
973058170 4:45686628-45686650 AAATACTTGAAGAAGTGAAGAGG + Intergenic
973909244 4:55563053-55563075 AAAGACTGGAAGAAGTTTGTTGG - Intronic
975480034 4:74867652-74867674 AAGAGCTTGAAGAAGTTTCTTGG + Intergenic
976317790 4:83677932-83677954 AAATGCTTAAATAAGTTTTGAGG - Intergenic
976615295 4:87069905-87069927 AATTGCTTGAACAGGGTTGGGGG - Intronic
976786081 4:88823180-88823202 CATTGCCTGAAGAAGTTTGGAGG - Intronic
977047587 4:92087402-92087424 AAATACTGGAAGATGTTAGGTGG - Intergenic
979417085 4:120455216-120455238 AAGAGCTAGAAGAAGTTGGGTGG - Intergenic
979681079 4:123460590-123460612 AAATGCTTTAAGGAGTTTGTTGG - Intergenic
979726512 4:123969088-123969110 ATATGCATGAAGAAACTTGGGGG + Intergenic
980059628 4:128115260-128115282 ACATGATTTAAGAATTTTGGAGG + Intronic
981427409 4:144619487-144619509 AAATGCTTGAGGAAATTTTATGG - Intergenic
981596940 4:146435228-146435250 AAGTCCATGATGAAGTTTGGAGG + Intronic
981675250 4:147335866-147335888 AAATCCTTGAGAAAGTATGGTGG + Intergenic
981884228 4:149653500-149653522 AAAAGCCTGAAGAAGTGTGCAGG - Intergenic
986630315 5:9766425-9766447 AAATGCTGGAAGAAGGTAGCAGG + Intergenic
987268384 5:16279612-16279634 AAATGCAAGAATAAGTTTGGTGG + Intergenic
987276225 5:16365404-16365426 AAATGCTTGATAATGATTGGGGG + Intergenic
988167371 5:27611445-27611467 CAATCTTTGAAGAAGCTTGGAGG + Intergenic
988197694 5:28026944-28026966 AAATGCTTGAAGAAATATTTTGG - Intergenic
990029470 5:51239617-51239639 AAATTCTTTAAAAATTTTGGTGG + Intergenic
990208243 5:53453397-53453419 AAAGATTTTAAGAAGTTTGGTGG + Intergenic
990451824 5:55940287-55940309 AGATGCTTGAGATAGTTTGGGGG + Exonic
994368993 5:98947820-98947842 AAATGCTGGAAGAAGGTTGTGGG + Intergenic
995033272 5:107504087-107504109 AAATGCTCGAAGAAAATAGGAGG - Intronic
995139074 5:108714121-108714143 AAACCATTGAAGAAGTTTGGGGG - Intergenic
996687556 5:126300626-126300648 TAATGTTTTAAGAAATTTGGTGG - Intergenic
996972798 5:129393386-129393408 AAATGCTTTAAGAATTTTATAGG - Intergenic
998014188 5:138719234-138719256 AAAGGCCTGAAGGAGTTGGGAGG - Intronic
1000425824 5:161090312-161090334 TAATGTTTGAATAAGTTTAGAGG - Intergenic
1000716775 5:164653717-164653739 AAAGGCTTGGAGATGTTGGGAGG - Intergenic
1001143981 5:169168089-169168111 AAATGCTTGAAGAGATGGGGAGG - Intronic
1001445516 5:171779739-171779761 AAATACTTGGAGAAGTGAGGAGG + Intergenic
1001721165 5:173858127-173858149 AAATGCAATAAGATGTTTGGAGG + Intergenic
1001782196 5:174379206-174379228 AAATGTGTTAAGGAGTTTGGTGG - Intergenic
1002553754 5:180018206-180018228 AATTGCTTGAACAAGGGTGGTGG + Intronic
1003127744 6:3369123-3369145 AAATGCTAGAAGAAGACTAGAGG - Intronic
1003240004 6:4336325-4336347 AAATGGGGGAAGAAGTTTTGAGG + Intergenic
1003401859 6:5797131-5797153 AAATGGTTGGAACAGTTTGGAGG - Intergenic
1003938979 6:11005246-11005268 AAATGCTGGAATAAGTTTTTAGG + Intronic
1004276209 6:14237372-14237394 AAATATTTGAGGAAGTTTGCAGG - Intergenic
1004313011 6:14562485-14562507 AAATGTGTGCAGAAGTCTGGCGG + Intergenic
1004522757 6:16377807-16377829 AAATGCTTGTAAAACTATGGCGG + Intronic
1005510020 6:26504382-26504404 AAATGTTTGCAGCAGTTTGGTGG - Intronic
1008428985 6:51392586-51392608 AAAAGCTTGAAGGAGGATGGAGG - Intergenic
1008970218 6:57358444-57358466 AAATCCTTCAAGAAGGTTGCTGG + Intronic
1009159186 6:60260268-60260290 AAATCCTTCAAGAAGGTTGCTGG + Intergenic
1010911215 6:81559482-81559504 AAATATTTGAAGAACTTAGGAGG + Intronic
1013931678 6:115542141-115542163 AAATGCTTGAAGTTGTTTGATGG + Intergenic
1014441643 6:121480324-121480346 GAATCTTTCAAGAAGTTTGGCGG - Intergenic
1014770806 6:125456047-125456069 AATTCCTTGAAGAAGTTCTGTGG + Intergenic
1015428474 6:133101326-133101348 AAATGCTTGAAGAGGTATTCTGG + Intergenic
1015491066 6:133826023-133826045 AAATACCTGAAGAGGATTGGAGG - Intergenic
1015561943 6:134525457-134525479 AAGTGCTTGAAGGATTTTGTGGG + Intergenic
1016200306 6:141398669-141398691 GAATGCTTGAAGAAATTTGTTGG + Intergenic
1016730869 6:147426222-147426244 AAATGGTTGTAGATGTGTGGTGG + Intergenic
1020909136 7:14106360-14106382 AAATATTTGAAAAAGTTTGCTGG + Intergenic
1021032115 7:15750121-15750143 AAAGCCTTGCAGAATTTTGGGGG + Intergenic
1021512556 7:21450314-21450336 AAATGATTTAGGAAATTTGGTGG + Intronic
1021662276 7:22931560-22931582 AATTGCTTTAAAAAGTTTGCTGG + Intergenic
1023221372 7:37922649-37922671 TAATGCTTGAGGAAGCTAGGGGG + Intronic
1023412990 7:39905862-39905884 AAATCCTGAAAGAAGTTAGGAGG + Intergenic
1024177582 7:46856785-46856807 AAATCCTGGCAGAAGTTAGGTGG - Intergenic
1024381408 7:48701298-48701320 CATTGCTTGTAGAAATTTGGAGG + Intergenic
1024572218 7:50732707-50732729 GAAAGCTTGATGAAGTTTGCAGG - Intronic
1025275400 7:57578421-57578443 AAAATGATGAAGAAGTTTGGGGG - Intergenic
1028412579 7:90546699-90546721 AAATGGTTGTAGATGTGTGGTGG + Intronic
1028831287 7:95329058-95329080 ATAGGCATGAAGAAATTTGGAGG - Intergenic
1028882426 7:95894815-95894837 AGATGCTTGAAGAAGTCAGTTGG + Intronic
1029040923 7:97573972-97573994 AAATCCTTCAAAAAGTTTTGAGG + Intergenic
1030506090 7:110424772-110424794 AAATCCTTTAAGAATTTAGGAGG + Intergenic
1031964589 7:128018497-128018519 ACATATTTGAAGAGGTTTGGGGG + Intronic
1033138143 7:138801667-138801689 AAATGCTTGAAGAAGTTTGGAGG + Intronic
1033287372 7:140054017-140054039 AAATGAAACAAGAAGTTTGGTGG + Intronic
1033619107 7:143046450-143046472 GAATGTTTGAACATGTTTGGTGG - Intergenic
1038893082 8:31749456-31749478 AAAAGATTGAAGAAGTGTAGAGG + Intronic
1040614814 8:49024532-49024554 TAATGTTTGAAGTATTTTGGGGG + Intergenic
1041051669 8:53940596-53940618 AAATGCCCGGGGAAGTTTGGTGG + Intronic
1041762101 8:61378456-61378478 AAATACTAGAAGACCTTTGGAGG + Intronic
1042057771 8:64785202-64785224 ACATGCTTGAAAACATTTGGTGG - Intronic
1043100282 8:76036685-76036707 AAATCCCTGCAGAAGTTTTGTGG + Intergenic
1043283183 8:78495164-78495186 AAATGCTTGAAAAAGTTTTTAGG + Intergenic
1043412792 8:80016278-80016300 AAATTCTAAAAGAAGCTTGGGGG + Intronic
1043539774 8:81247501-81247523 AAAATCTTGAAAAAATTTGGAGG + Intergenic
1043977901 8:86603794-86603816 AAATGAGAGAAGAGGTTTGGAGG - Intronic
1044257721 8:90084864-90084886 AAATGCTAGAAAAAGTATGTAGG + Intronic
1044390000 8:91638882-91638904 AAAAGAAGGAAGAAGTTTGGAGG - Intergenic
1046310800 8:112434453-112434475 AAATGCTGGTAGACTTTTGGAGG - Intronic
1047498293 8:125424084-125424106 AAATGAATTAAAAAGTTTGGGGG - Intergenic
1051691619 9:19719131-19719153 TATTGCTTGAAGAAGTTTTCTGG + Intronic
1052493450 9:29195040-29195062 TAGTGCTTGACAAAGTTTGGGGG - Intergenic
1052968451 9:34361203-34361225 AAATACTTGATGAAGTTGAGAGG - Intergenic
1055237031 9:74134168-74134190 AAATGTTTGAATAAATGTGGAGG - Intergenic
1056566821 9:87780026-87780048 AATTGCTTGAACCAGGTTGGTGG + Intergenic
1056587974 9:87940538-87940560 AAAATGGTGAAGAAGTTTGGGGG + Intergenic
1056608894 9:88112407-88112429 AAAATGGTGAAGAAGTTTGGGGG - Intergenic
1057459409 9:95246202-95246224 AAGAACTTGAAGAAGTTTAGGGG + Intronic
1057712970 9:97463938-97463960 AAATTCTTTAATAAGTTTGGAGG + Intronic
1058333041 9:103788763-103788785 AAAAACTTGGAGGAGTTTGGAGG - Intergenic
1058523697 9:105836739-105836761 AATTGCTTGGAGACCTTTGGAGG - Intergenic
1059583492 9:115578613-115578635 AAATGCTTTTATAATTTTGGGGG - Intergenic
1061112216 9:128582094-128582116 ACAAACTTAAAGAAGTTTGGAGG - Intronic
1061618126 9:131793483-131793505 AATTGCTTGAACACGGTTGGCGG - Intergenic
1203626622 Un_KI270750v1:31899-31921 AAAATGATGAAGAAGTTTGGGGG - Intergenic
1186053736 X:5627208-5627230 TCAGGCTTGAAGAAGTTTGCAGG + Intergenic
1186863183 X:13693376-13693398 AAATGTTTCAGGGAGTTTGGTGG + Intronic
1187233995 X:17449479-17449501 AGAGGCCTGAAGAAGTTTGCTGG + Intronic
1187547822 X:20268897-20268919 ACGTGCTTGCAGAAGTTTGGAGG + Intergenic
1188369241 X:29348712-29348734 AGATGCTGGAAGAATTTTGAGGG + Intronic
1193805919 X:85994344-85994366 AATTGCTTGCAGAAGTGTGCTGG - Intronic
1193845198 X:86461042-86461064 AACTGCTTGAAGCATTTCGGTGG - Intronic
1196970323 X:121100843-121100865 AGAGGTTGGAAGAAGTTTGGAGG - Intergenic
1197735246 X:129845552-129845574 AAATCCTTTAAGAATTTTGAAGG - Intergenic
1198119661 X:133579457-133579479 AAATGCTTGAAGCATATTGACGG + Intronic
1199095562 X:143734538-143734560 AAATGCTTGAAGGATTTTCTTGG - Intergenic
1199171128 X:144735316-144735338 AAGAGGTTGAAGCAGTTTGGAGG - Intergenic
1199657165 X:150007537-150007559 TAATGCATGAGGAAGTTTGAAGG + Intergenic