ID: 1033139025

View in Genome Browser
Species Human (GRCh38)
Location 7:138808719-138808741
Sequence CCTTAAATGTAGACAATTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 218}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033139025_1033139037 22 Left 1033139025 7:138808719-138808741 CCCTTAATTGTCTACATTTAAGG 0: 1
1: 0
2: 1
3: 10
4: 218
Right 1033139037 7:138808764-138808786 TTGCTTCCCCTCATCCTCCCCGG 0: 1
1: 0
2: 2
3: 47
4: 448
1033139025_1033139028 -9 Left 1033139025 7:138808719-138808741 CCCTTAATTGTCTACATTTAAGG 0: 1
1: 0
2: 1
3: 10
4: 218
Right 1033139028 7:138808733-138808755 CATTTAAGGCCCCATAAACCTGG 0: 1
1: 0
2: 0
3: 12
4: 88
1033139025_1033139029 -8 Left 1033139025 7:138808719-138808741 CCCTTAATTGTCTACATTTAAGG 0: 1
1: 0
2: 1
3: 10
4: 218
Right 1033139029 7:138808734-138808756 ATTTAAGGCCCCATAAACCTGGG 0: 1
1: 0
2: 2
3: 11
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033139025 Original CRISPR CCTTAAATGTAGACAATTAA GGG (reversed) Intronic
900905735 1:5555945-5555967 CTTTACATGTGTACAATTAAAGG + Intergenic
903119266 1:21204217-21204239 CCATAAATGTATACAATTTTTGG + Intergenic
904388269 1:30161816-30161838 CCTAAAGTGGAGACAGTTAAAGG - Intergenic
904437671 1:30509146-30509168 CCTGAAGAGTAGATAATTAAAGG - Intergenic
906782382 1:48584236-48584258 TCTTGAATGTAGACAATGGAAGG - Intronic
907039184 1:51242802-51242824 AGTTAAATTTAGATAATTAAAGG + Intronic
910340957 1:86186797-86186819 CCTTAAATGTAGAGAATATGGGG - Intergenic
911463981 1:98227932-98227954 CCTTAAATTTAGAAAATTTGAGG - Intergenic
911863540 1:102987063-102987085 CATTAGATGTTGAGAATTAAAGG - Intronic
913606572 1:120472651-120472673 CCTTAAATATATATAATTTAAGG - Intergenic
914209858 1:145567490-145567512 CCTTAAATATATATAATTTAAGG + Intergenic
914368317 1:147001005-147001027 CCTTAAATATATATAATTTAAGG - Intergenic
914584624 1:149049190-149049212 CCTTAAATATATATAATTTAAGG + Intergenic
916763294 1:167836048-167836070 CCATACAGGTAGACAATTCATGG + Intronic
918678967 1:187327246-187327268 CCTTATATGTGAACAATTTAAGG + Intergenic
919253402 1:195089869-195089891 TTTTAAATGTGGACAATTATAGG - Intergenic
920243029 1:204567683-204567705 CCTTAAACGTAGACTATAGATGG + Intergenic
920654192 1:207863322-207863344 CCTTAAAGGCAGTCACTTAAAGG + Intergenic
920821042 1:209381130-209381152 CCTAGAATGTTAACAATTAATGG + Intergenic
922025563 1:221744974-221744996 CCCTAAACATAGACAATTATGGG + Intergenic
922139232 1:222865621-222865643 TTTTAAGTGTAGACATTTAAAGG + Intergenic
924573606 1:245259614-245259636 TCTTGAATGTTGATAATTAATGG + Intronic
1065065996 10:21965528-21965550 CCTTAAATGTAAACATCTAGAGG - Intronic
1065333492 10:24629469-24629491 CCTAAAATGTTCACAATGAACGG - Intronic
1065598075 10:27336814-27336836 CCGTAAATGTTTACATTTAAAGG - Intergenic
1065808291 10:29416329-29416351 CAATAAATGTAAACAAATAAAGG - Intergenic
1067902148 10:50253248-50253270 CCTCAAATGTAGACTAGGAAAGG - Intergenic
1069140873 10:64823578-64823600 CCTTGAAGGTAGAGGATTAAAGG + Intergenic
1070885725 10:79896019-79896041 TCTTAAATGCTGACATTTAATGG - Intergenic
1072566867 10:96623849-96623871 CCTTAAAATTAGAGAATAAAAGG + Intronic
1073734579 10:106331052-106331074 ACTTAAAAGTAGGGAATTAAAGG - Intergenic
1073805770 10:107096157-107096179 CCTTAAATGCAGATAATATATGG + Intronic
1074245777 10:111690537-111690559 CCTTAAATGTACACAAATAATGG + Intergenic
1074946066 10:118281851-118281873 CCTTGAATATAAACAAGTAAGGG - Intergenic
1076328584 10:129647348-129647370 CGTTAAATGCATAAAATTAAAGG + Intronic
1078346387 11:10553528-10553550 CCTTATATATAGACTATTACAGG + Intergenic
1079252917 11:18800565-18800587 CCTTACATTTATACAAATAAAGG + Intergenic
1079672061 11:23183721-23183743 TATTAAATGTTGACAAATAAAGG + Intergenic
1080202266 11:29686165-29686187 CCTTAAATGGATTCAATTCAAGG + Intergenic
1081517961 11:43851952-43851974 CCCTAATTGTAAACAAATAAGGG - Intronic
1085706785 11:78793614-78793636 CCTCAAATGCTGACTATTAATGG - Intronic
1085882266 11:80481485-80481507 CCTTAATTGTAGAGAATGTATGG + Intergenic
1091933799 12:4418398-4418420 CCTTAACTGTAGAGAAAAAAGGG + Intergenic
1093008243 12:14075303-14075325 CTTTAAATGTATACAAGAAAGGG + Intergenic
1097730054 12:63118391-63118413 CCTTAAAACTCAACAATTAAAGG - Intergenic
1098654457 12:73010345-73010367 TGTTTAATGTAGACATTTAATGG + Intergenic
1099164589 12:79287788-79287810 TCTCAAATATAGAGAATTAATGG + Intronic
1099731306 12:86507364-86507386 CCTTACATGAAGCCAAATAAAGG - Intronic
1099799856 12:87443282-87443304 CCTTAACTGTAAACATCTAAAGG + Intergenic
1100000729 12:89832044-89832066 CCAAAAATGTAGACAAGGAAAGG - Intergenic
1101218562 12:102611137-102611159 GGTTAAATGCAGACAAATAAGGG - Intergenic
1106977073 13:35232065-35232087 CCTGAAATCTGGACAAATAAGGG - Intronic
1107369324 13:39726127-39726149 CCCTAAATGGAGACAACAAATGG - Intronic
1107811924 13:44208795-44208817 CCTTGAAAGTACACAAATAATGG - Intergenic
1109976932 13:69849667-69849689 CCATATATGTAGTCACTTAAAGG + Intronic
1110024688 13:70520882-70520904 CCATAAATGTCAACAATCAACGG + Intergenic
1110106754 13:71686501-71686523 CCTTAAATAAAAACAATAAATGG - Intronic
1110226398 13:73124205-73124227 TCCTAAATGTAGTCAATTATTGG - Intergenic
1110285645 13:73747219-73747241 CCTTACATGCACACAATTGAGGG + Intronic
1111563944 13:89990419-89990441 ACTGAAATATATACAATTAAAGG + Intergenic
1111873624 13:93865772-93865794 CCTTAAATTTCTAAAATTAATGG - Intronic
1112522163 13:100106008-100106030 CCTTAAAGGTAAAGAATTAAAGG - Intronic
1115175837 14:30560210-30560232 CCATAAATGTAAACTATAAATGG + Intronic
1115587071 14:34825064-34825086 CCTAAAATTCAGACAATTGATGG - Intronic
1115929022 14:38469620-38469642 CTCTAAATATAAACAATTAAAGG + Intergenic
1116065055 14:39971793-39971815 CCTTAACTGTAAACATTTAGAGG - Intergenic
1116315315 14:43381616-43381638 CCTTAAATGTTGGAAATAAAGGG - Intergenic
1116500956 14:45620900-45620922 TTTTAAATGCAGACAATTACAGG + Intergenic
1116637367 14:47414438-47414460 CAGTAAATGTTGACTATTAATGG + Intronic
1119011957 14:71002402-71002424 TGTTAAATGTATACAATTCAAGG + Intronic
1119945233 14:78686431-78686453 CCATCAAAGCAGACAATTAATGG - Intronic
1121775195 14:96585840-96585862 ACTTAAATGTACACAAATAGCGG + Intergenic
1122801975 14:104235603-104235625 CCTTAAGTGGAGACATTGAATGG + Intergenic
1123454536 15:20408190-20408212 TCTTTATTGTAGGCAATTAAAGG - Intergenic
1124476144 15:30036629-30036651 CATTTAATGTAGATATTTAATGG + Intergenic
1131541938 15:93281763-93281785 CCTTAACTGTAAACATTTAGAGG + Intergenic
1133679938 16:8111374-8111396 CCTTAAACGTACACATTTAGAGG - Intergenic
1135610554 16:23862847-23862869 CCTTAACTGTAGACATCTAGAGG - Intronic
1135837439 16:25839434-25839456 TCTTAAAGGTAGAAAATTATGGG - Intronic
1138308022 16:55996103-55996125 CCTTAAATGTATGTAATTATTGG - Intergenic
1141405380 16:83788106-83788128 CCCAGAAAGTAGACAATTAAGGG + Intronic
1146952123 17:36913978-36914000 CTTTAAATATATAAAATTAAAGG + Intergenic
1149443493 17:56695103-56695125 CCTTAAATGCATACTACTAAGGG - Intergenic
1150413303 17:64965237-64965259 CCTTTAATGTAGACATTAAACGG + Intergenic
1150798513 17:68259978-68260000 CCTTTAATGTAGACATTAAACGG - Intronic
1150893358 17:69180530-69180552 TATTAAAAGTAAACAATTAAGGG + Intronic
1154508727 18:15070404-15070426 TTTTAAATGTAGACATTTATGGG - Intergenic
1160540983 18:79622713-79622735 CTTTCAATGTAGATTATTAAAGG + Intergenic
1166627352 19:44370886-44370908 CCTTAAATGGAGACTATGGAGGG + Intronic
1202708460 1_KI270714v1_random:2392-2414 CCTTAAATATATATAATTTAAGG - Intergenic
926467462 2:13208280-13208302 TCTTACATGTATATAATTAAGGG + Intergenic
929167134 2:38893878-38893900 TCTAAAATGTAGGCAATTCAAGG + Intronic
929500979 2:42491846-42491868 CCTTAAATTTAAAAAATGAATGG + Intronic
930320859 2:49853217-49853239 AGTTAAATGCAGAAAATTAAAGG - Intergenic
931053397 2:58439576-58439598 CTTTAAATGTATCCAAATAAGGG - Intergenic
931555244 2:63496531-63496553 GTTCAAATGTAGAGAATTAATGG - Intronic
931612453 2:64116995-64117017 CCTTATATGGACACAATTCAGGG - Intronic
933403579 2:81829912-81829934 CCTTAATTTTAGATATTTAATGG - Intergenic
933469827 2:82707784-82707806 CCATGAATGTAGACTTTTAATGG - Intergenic
934095525 2:88599174-88599196 CCATAATTCTAGACATTTAAGGG + Intronic
936139384 2:109926279-109926301 CCTTAAATGTAGAGAATCCTGGG + Intergenic
936205312 2:110445207-110445229 CCTTAAATGTAGAGAATCCTGGG - Intronic
936377124 2:111950576-111950598 TCTTAAGTGTAGACATTTAGTGG + Intronic
938546146 2:132333671-132333693 CCTTAAATGGAGACTATGGAGGG - Intergenic
939202752 2:139059167-139059189 ACTTAAATGTAGATAGTTGATGG - Intergenic
939542945 2:143515766-143515788 ACTTATATGTAGAAAATCAATGG + Intronic
939762898 2:146206412-146206434 TCTTAATTTTAGACAATTAGGGG - Intergenic
939859304 2:147398279-147398301 GCATAAATGAAGACAAATAATGG - Intergenic
941839569 2:170066032-170066054 GCTAAAATGTAGAAACTTAATGG + Intronic
943730317 2:191295972-191295994 CTTAAAATGTATACAATGAATGG + Intronic
943945640 2:194059766-194059788 CCTTACATGTTAACAATTACTGG + Intergenic
944194528 2:197038524-197038546 CCTGAAATGTAGACAACCCAAGG - Intronic
944231828 2:197402826-197402848 CCTAAAATGTAAACAAAGAAAGG + Exonic
944651064 2:201830785-201830807 ACTTAAAAGTAGAGAAGTAATGG + Intronic
944939998 2:204614019-204614041 CTATAAATCTAGACATTTAAGGG - Intronic
945238633 2:207655893-207655915 CATTAATTGTTGACAAGTAATGG + Intergenic
945641213 2:212432553-212432575 CCTTAAAATTAGAAAATTTAAGG - Intronic
948095494 2:235330766-235330788 GCTTAAATATATACAATTTAAGG + Intergenic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1171875010 20:30566404-30566426 CCTTAAATGGAGACTATGGAGGG - Intergenic
1175352683 20:58336460-58336482 CCTTAAAAGTAGAGACTTTAAGG + Intronic
1176789350 21:13301329-13301351 TTTTAAATGTAGACATTTATGGG + Intergenic
1178709500 21:34902359-34902381 CCTTAAATGTGGACAATGGTGGG + Intronic
1182954786 22:34412939-34412961 CCTCAAATATACACAATAAAGGG - Intergenic
949234060 3:1787237-1787259 CCTTAAATGTGGAAGAATAAAGG - Intergenic
949751757 3:7359649-7359671 CCTTAGATAGAGACATTTAAAGG - Intronic
951722892 3:25720738-25720760 CATTAAATGTATACTATTTAAGG + Intronic
956199259 3:66689502-66689524 CATTAAATGCAGTCAATTAGAGG + Intergenic
956292134 3:67672253-67672275 CCTTAGGTGGAGAGAATTAAAGG - Intergenic
957427496 3:80058333-80058355 CCTTAAATATATACAATTTTTGG + Intergenic
957705343 3:83773087-83773109 TCTCAAATGTAGACATTCAAAGG - Intergenic
958598303 3:96259703-96259725 CCTTAAATGAAGAAAAGTGAAGG - Intergenic
959270424 3:104201725-104201747 CCTTATATATAAACAATCAATGG + Intergenic
963364849 3:144321923-144321945 ACAAAAATGTAGACAGTTAATGG + Intergenic
964560108 3:157985611-157985633 CCTAAAATGTAGGCATTTATGGG + Intergenic
965567148 3:170132147-170132169 CTTTAAATTCAGAGAATTAATGG + Intronic
965767763 3:172149296-172149318 CTTTAAATGAAGACACCTAACGG + Intronic
970125571 4:12806174-12806196 GCTTAAATGTAGGAAAGTAAAGG - Intergenic
970726064 4:19046132-19046154 CCTGAAATGAAGACAATAAATGG + Intergenic
972043700 4:34637670-34637692 TCTGAAATCTAGAAAATTAAGGG - Intergenic
972190302 4:36583521-36583543 GCTGATATGTAGAGAATTAAAGG - Intergenic
973030970 4:45338611-45338633 ACATACATGTAAACAATTAACGG - Intergenic
973171807 4:47154556-47154578 CCTTTAATGTATGCAATTATTGG + Intronic
974757575 4:66230716-66230738 CCTGAAATGAACACAATTATGGG - Intergenic
976689961 4:87858416-87858438 CCATAAATGTAAACTCTTAAAGG - Intergenic
977028362 4:91849850-91849872 CCTTAATTGTGGCCAATCAATGG + Intergenic
978625368 4:110679438-110679460 ACATAAAAGTAAACAATTAAGGG + Intergenic
978845074 4:113263596-113263618 CCTTAAATCTAGAAACTTTAAGG - Intronic
980181671 4:129408695-129408717 CCTTAAATGTATACACTTTTGGG + Intergenic
981094698 4:140766381-140766403 CCTTAAATATAAAACATTAAGGG + Intergenic
981659111 4:147145659-147145681 CCTCAGATGCAGACAAGTAATGG + Intergenic
983046266 4:162990094-162990116 CCTTAATTGTAAACATTTAGAGG - Intergenic
983046268 4:162990095-162990117 CTCTAAATGTTTACAATTAAGGG + Intergenic
983570159 4:169198009-169198031 CTTTAAATGTAGAAATGTAAAGG + Intronic
984906882 4:184636653-184636675 GATTAAATGTAGTAAATTAAAGG + Intronic
985021289 4:185693458-185693480 CCTTAAATGGACAAAATAAATGG + Intronic
985172903 4:187171221-187171243 CTTTAAATTTTGACGATTAATGG + Intergenic
986813484 5:11384256-11384278 AATGAAATGTAGACAACTAAAGG + Intronic
986821788 5:11475363-11475385 CCCTAAAAGTGAACAATTAATGG + Intronic
988353003 5:30136551-30136573 CCTTACATGAAGACATTTATTGG - Intergenic
988951380 5:36265098-36265120 CCTTAAAAGAATAGAATTAAAGG + Exonic
991393715 5:66180031-66180053 CATCCAATGTAGACAACTAAAGG - Exonic
991982534 5:72248026-72248048 CTTTACATGTAAACAACTAAGGG - Intronic
992336525 5:75775931-75775953 TCTTAAATGTGGAGAATTTAAGG + Intergenic
993284807 5:85980041-85980063 CCATAAATGTAGAAAAGTATTGG + Intergenic
995913599 5:117216542-117216564 CTTTACATGTAAACAATTTAAGG + Intergenic
996518321 5:124398361-124398383 CCTCAAATGTAAACAATAGAAGG - Intergenic
1000231772 5:159322239-159322261 TCTTCAATGTAGACAAGGAAGGG + Intronic
1000495763 5:161982423-161982445 TCTGAAATGTAGAAAATAAAAGG - Intergenic
1001022254 5:168193123-168193145 CTTTAAATGTAAACAATAAATGG + Intronic
1001202261 5:169728896-169728918 CCTGTGCTGTAGACAATTAAGGG + Intronic
1004938295 6:20529400-20529422 GCTTCAATGTAGAGAATAAAAGG - Intergenic
1011147368 6:84233515-84233537 CTTGAAATAAAGACAATTAATGG + Intergenic
1011935028 6:92766016-92766038 CCCTTAATGTATACATTTAAGGG - Intergenic
1011947157 6:92920306-92920328 ACTTAAATGAAGAAAATTCAAGG - Intergenic
1012760142 6:103291169-103291191 TTTTAAATGTAAACAATTAAAGG - Intergenic
1015823404 6:137286645-137286667 CCTTAAATGCAGTAAATTGAAGG + Intergenic
1015979061 6:138820525-138820547 CTTTCACTGTAAACAATTAACGG - Intronic
1016179342 6:141124859-141124881 CCTTAAATGTAGTCTATTTTGGG + Intergenic
1016258480 6:142138667-142138689 CCTTGAATGCAGGCAATCAAGGG - Intergenic
1016667091 6:146654650-146654672 CCTTAAATATACACAATTTTTGG - Intronic
1017498374 6:155001386-155001408 CCTTAATTGTAAACAAATAAAGG + Intronic
1018624855 6:165767313-165767335 CTTTAAAAGTACACAATTCAGGG + Intronic
1021437444 7:20636335-20636357 ATTTAAAAGTAGACAATAAAAGG + Intronic
1021763911 7:23928039-23928061 CCTGAGATGTAGTCATTTAAAGG + Intergenic
1022836829 7:34125889-34125911 TCTGAAATGTATCCAATTAATGG + Intronic
1024012935 7:45285776-45285798 CCCTAAATTTAGAAAAATAATGG + Intergenic
1027806371 7:82829523-82829545 ATTTGAATGTACACAATTAAGGG + Intronic
1028430564 7:90742832-90742854 TCTTAAATATACACAATAAATGG - Intronic
1028553914 7:92102582-92102604 CCCTAAATATAGAGAATTTATGG + Exonic
1030853943 7:114526824-114526846 CTTTTAATGTATACAATTCAGGG + Intronic
1032664488 7:134021962-134021984 CCTTTAATGTTGTCAATAAAAGG - Intronic
1032884604 7:136124229-136124251 TTTCAAATGTAGACAGTTAATGG - Intergenic
1033139025 7:138808719-138808741 CCTTAAATGTAGACAATTAAGGG - Intronic
1033218909 7:139514708-139514730 CCATAAATATATACAATTATAGG - Intergenic
1035798113 8:2378297-2378319 CTTTAAATGTAGACATTTTTAGG - Intergenic
1036047843 8:5163842-5163864 ACTTAAATGCAGATTATTAAGGG - Intergenic
1039624466 8:39033824-39033846 CCATAAAAGAAGACAAATAAAGG - Intronic
1040946325 8:52888582-52888604 ACTTAAATGTAGTCACTTAATGG + Intergenic
1041088730 8:54282056-54282078 TCTTAAATGTACACTATTAAAGG + Intergenic
1042403464 8:68376460-68376482 CCTTGAAAGTAGAGAATGAAGGG + Intronic
1043599701 8:81922706-81922728 ATTTAAATGTAGATAATTCATGG - Intergenic
1047089444 8:121557529-121557551 CCTAAAATATAGAAAAATAAGGG + Intergenic
1051491536 9:17672333-17672355 CCCTAAATGTAAATAATTGATGG + Intronic
1052106897 9:24529824-24529846 CCTTACATGGAGACATATAAAGG + Intergenic
1053597413 9:39576642-39576664 TCTTAAATGTAGATAATCATGGG - Intergenic
1053855431 9:42333615-42333637 TCTTAAATGTAGATAATCATGGG - Intergenic
1054568851 9:66788354-66788376 TCTTAAATGTAGATAATCATGGG + Intergenic
1056120599 9:83484084-83484106 CCTTAAAAGAATACATTTAAAGG + Intronic
1058550613 9:106110888-106110910 CTTTAAATGAGGACTATTAAAGG + Intergenic
1059864812 9:118502464-118502486 TTTTAAATGTATACATTTAAGGG + Intergenic
1186569662 X:10700722-10700744 CCTTCAATAAATACAATTAAAGG + Intronic
1187240619 X:17509710-17509732 GCTTAAAGGTAGACAATCCAGGG + Intronic
1188428355 X:30075855-30075877 CCTGAAATATAGACAAGCAAGGG - Intergenic
1188874820 X:35416830-35416852 CTTTAAGTGTAAACAATTAAGGG + Intergenic
1188949065 X:36346082-36346104 CTTTAAATGTAGACATTCATAGG + Intronic
1190624004 X:52318462-52318484 ACTTAAATGTATACAATGACAGG - Intergenic
1192531247 X:71888609-71888631 ATTAAAATGTAGACATTTAAGGG - Intergenic
1193260483 X:79400800-79400822 CATTCAATGAAGACAATAAAAGG + Intergenic
1194098424 X:89673378-89673400 CCTTAGATGTGGGCCATTAATGG - Intergenic
1194195777 X:90890354-90890376 TCTTAAATTTAGAAAAATAATGG - Intergenic
1194912515 X:99664269-99664291 TCTAAAATGTAGATAAATAAAGG + Intergenic
1195712351 X:107783671-107783693 CCTTAAATATATACAATTCTTGG - Intronic
1195955307 X:110322770-110322792 GCTTAAATGTTCACAATTTATGG + Intronic
1196013009 X:110908160-110908182 CCTTAAGTGTTGGCAATTCATGG - Intergenic
1199618502 X:149678233-149678255 CTTTAAATTTAAAAAATTAAGGG + Intergenic
1199624140 X:149725016-149725038 CTTTAAATTTAAAAAATTAAGGG - Intergenic
1199864064 X:151827371-151827393 CCTTGATTGTTGACAATGAATGG - Intergenic
1200541632 Y:4464548-4464570 TCTTAAATTTAGAAAAATAATGG - Intergenic
1200757299 Y:7001852-7001874 CCTTAAATGTAGACAAAATGGGG + Intronic