ID: 1033141208

View in Genome Browser
Species Human (GRCh38)
Location 7:138828487-138828509
Sequence CACCCACCCCCATTTATTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033141207_1033141208 30 Left 1033141207 7:138828434-138828456 CCTAGATTTGTGGCTACAATTTT 0: 1
1: 0
2: 3
3: 19
4: 266
Right 1033141208 7:138828487-138828509 CACCCACCCCCATTTATTCCAGG 0: 1
1: 0
2: 0
3: 20
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033141208 Original CRISPR CACCCACCCCCATTTATTCC AGG Intronic
903116702 1:21184185-21184207 CACACACCACCATATATCCCTGG - Intergenic
904092082 1:27952362-27952384 CAGCCTCCCTCATTTGTTCCAGG + Intronic
904544295 1:31256321-31256343 CACCCACCCTCATCTTTTCTTGG - Intergenic
905127076 1:35723208-35723230 CACCTACCCACATATATGCCAGG + Intronic
910757683 1:90709387-90709409 CACCCACCCAACTTTCTTCCTGG + Intergenic
911091193 1:94018702-94018724 CATCAACCCCAATTTATTCTAGG - Intronic
911747050 1:101451753-101451775 CAACCTCCCCAAATTATTCCTGG - Intergenic
912660467 1:111524616-111524638 CCCCTACCCCCATTTTTTTCTGG + Intronic
913181761 1:116329359-116329381 CACTCACCCCCAATTATTACCGG - Intergenic
916723165 1:167500595-167500617 CACACACACCCATTTATGCAGGG + Intronic
919132685 1:193471126-193471148 AACCAAGCCCCATTTATTTCTGG + Intergenic
920170220 1:204067353-204067375 CACCCACCCCCACCTAACCCAGG - Intergenic
920305390 1:205015190-205015212 CACCCACCCCCAGTCCTTCCTGG - Intronic
922526827 1:226310144-226310166 CTCCAACCCCCATAAATTCCTGG - Intergenic
922896299 1:229102969-229102991 CCCCCAGCCCCATTTTATCCAGG - Intergenic
924597520 1:245460429-245460451 CAGCCACCCCCATTTTTTACAGG + Intronic
1070702809 10:78615809-78615831 CCCCCATCCCCATTTCTTCATGG + Intergenic
1072505265 10:96059847-96059869 TACCCACCCACATTCATCCCCGG - Intronic
1072631598 10:97150582-97150604 CACCCACCCCCACCCCTTCCAGG + Intronic
1074159816 10:110828344-110828366 CAGCAACCCCCATTTATTCTGGG + Intronic
1076444291 10:130501279-130501301 CACCCCCCCCCCTTCCTTCCAGG - Intergenic
1077005930 11:356091-356113 GCCCCACCCCCATCCATTCCTGG - Intergenic
1081738810 11:45423851-45423873 CACCCTACCCCAATTATGCCTGG + Intergenic
1083796145 11:65017842-65017864 CAGCCACCCTCATTTGTTTCTGG - Intronic
1083979776 11:66157586-66157608 CTCCCACCCTCATTTATAACAGG - Intronic
1084646513 11:70462000-70462022 CACCCACCCCATTTTGTTCCTGG + Intergenic
1088557059 11:111072632-111072654 CACCCACCCCAGTTTATTTTTGG - Intergenic
1092744835 12:11663393-11663415 CACCGTCCTGCATTTATTCCAGG + Intronic
1095659269 12:44710152-44710174 CACCCACTCCCATTTTTAGCAGG - Intronic
1095795653 12:46216204-46216226 TCCCCACCCCCAATTATTCTAGG + Intronic
1095829851 12:46573137-46573159 CACCCACCCCCAACTCTTCTAGG + Intergenic
1096996833 12:55843451-55843473 CACCTACACCCACATATTCCAGG - Intergenic
1097460011 12:59850136-59850158 CACCCACCTCCATATTTACCTGG - Intergenic
1100316264 12:93447518-93447540 TACCCACCCCCAAATATTCCAGG + Intergenic
1102181886 12:110919097-110919119 CACCCACCTCCTTAAATTCCTGG + Exonic
1102934150 12:116882669-116882691 CACCCAGCTCCAATTATTCTAGG + Intergenic
1103703843 12:122861074-122861096 CACCCACCCCCATTCAGCCTCGG - Intronic
1104929438 12:132329950-132329972 CCCCCTCCCCCATTCACTCCCGG - Intergenic
1104968548 12:132520842-132520864 CACCCACCCACAGTTGTGCCAGG + Intronic
1110249796 13:73368881-73368903 CAGCCACCTCCATTTGCTCCGGG - Intergenic
1114177886 14:20339944-20339966 CACATATCCCCATTTATTGCTGG + Intergenic
1114896768 14:27000740-27000762 CACCCACCACCATTTATTGTGGG - Intergenic
1115754744 14:36519781-36519803 CCCCCACCCCCATTTTTTGTGGG + Intronic
1117389867 14:55252447-55252469 CACCCACCCCCAAATATTTTCGG + Intergenic
1117672312 14:58121161-58121183 GATCCACCCCCAATTATTCTTGG + Intronic
1118128338 14:62934853-62934875 CACCCACCCCCATGTTTTCTGGG - Intronic
1121052172 14:90826659-90826681 CACCCACCACAGTTAATTCCTGG - Intergenic
1121915116 14:97831645-97831667 CACCCTCACACATTCATTCCTGG - Intergenic
1124999071 15:34753043-34753065 CCCCCACCCCCAGTTCCTCCAGG + Exonic
1125256176 15:37766042-37766064 CACACACCCCTATTAATTCAAGG - Intergenic
1125289420 15:38129673-38129695 CACTCACCCCCACTTGTTCTGGG + Intergenic
1127496362 15:59516270-59516292 CACCCACCACCATCCATCCCTGG + Intronic
1128017010 15:64356341-64356363 AACCCACCCCCATTTCTTCTGGG + Intronic
1129128160 15:73463954-73463976 CCCCCATCCCCATTAATGCCTGG + Intronic
1131830674 15:96352790-96352812 CTCTCACACACATTTATTCCAGG + Intergenic
1133013056 16:2925463-2925485 CACTCATCCCCATTCATCCCTGG + Intronic
1139427459 16:66891648-66891670 CTCCCAGCCCCACTCATTCCAGG - Intronic
1140292134 16:73669447-73669469 AACACACCACCATATATTCCTGG + Intergenic
1143621675 17:8084493-8084515 CACCCAACCCCATTCCTGCCTGG + Intronic
1144763584 17:17721171-17721193 ACCCCACCCCCATTTTATCCAGG + Intronic
1146694759 17:34900027-34900049 CCCCCACCCCCACTCATCCCAGG + Intergenic
1147150726 17:38512013-38512035 CACACACCCTCACTCATTCCAGG + Exonic
1149703120 17:58672007-58672029 CACCCACCCCCTGTTATCCGTGG - Intronic
1149930334 17:60747058-60747080 CACCCACACCCATTTATCATTGG - Intronic
1150266882 17:63837755-63837777 CGCCCACTCCCCTTTGTTCCTGG - Intronic
1150577332 17:66441905-66441927 CATCCACCCACATTTATTAGTGG - Intronic
1150822395 17:68445993-68446015 CAGCCAGCTCCTTTTATTCCAGG + Intronic
1150833470 17:68543310-68543332 CACCCACTCCTATTTATCCAAGG - Intronic
1150987178 17:70212095-70212117 CCACCACCCACATTTATTCCAGG + Intergenic
1151713411 17:75819342-75819364 CGCCCACCCCCACTGATCCCGGG + Intronic
1158381145 18:56931663-56931685 CAGCAAACCCCATTTATTCCAGG - Intronic
1159393766 18:67830266-67830288 CACCCACCCCAATCTTTGCCAGG - Intergenic
1162631778 19:11933536-11933558 CTGCCACCCCTATTTATCCCTGG + Intronic
1163186704 19:15644058-15644080 CACCCACCACCAAGTATTCCAGG - Intronic
1165285716 19:34839761-34839783 CACCCAACCTCATCTCTTCCTGG + Intergenic
1166230036 19:41421336-41421358 CCCCCACCCTCATATACTCCAGG - Intronic
1166332363 19:42086449-42086471 CACCCACCCCCATTCCAACCTGG + Intronic
1167393560 19:49212130-49212152 CACCCACCCACCTCCATTCCAGG - Intergenic
1167792407 19:51690215-51690237 CCCCCAGCCCCCTTTTTTCCAGG + Intergenic
926378817 2:12263310-12263332 CACCAACCCCCCTGGATTCCTGG - Intergenic
927879534 2:26680934-26680956 CAGCCACCCCCATTTTTCCAAGG - Intergenic
928198039 2:29228951-29228973 CTCCCACCCCCACTTCTTCATGG + Exonic
928394459 2:30932927-30932949 TACACACACCCATTTCTTCCTGG + Intronic
930790283 2:55319359-55319381 GACACAGCCCCATTTATTCTGGG - Intronic
931711773 2:64993973-64993995 CATCTACCCTCATTTATTTCAGG - Intronic
933697874 2:85233698-85233720 CACCCACCCCCAAATTTCCCTGG + Intronic
935101731 2:100002104-100002126 CACACACCCTCATTTCTCCCAGG + Intronic
937505832 2:122535417-122535439 CACCCACCTCCATTTTTAACAGG - Intergenic
940027173 2:149220374-149220396 TACCCACCCCCATGTTTTGCAGG - Intergenic
942156802 2:173137899-173137921 TAACCATCCTCATTTATTCCAGG + Intronic
944221555 2:197309660-197309682 CCCCCACCCCCGTTTATTCGTGG - Intronic
945558481 2:211308318-211308340 CACCAACTCACATTTCTTCCAGG - Intergenic
946855565 2:223946349-223946371 CAATCAACCCCATTTGTTCCTGG + Intergenic
1170436376 20:16334133-16334155 CACACACACACATTCATTCCAGG - Intronic
1170722906 20:18900080-18900102 CACCCATCCCCATTAGTTCTGGG + Intergenic
1171117059 20:22534080-22534102 CACCCAGCCCCAGTTATTTGTGG - Intergenic
1177355986 21:20008413-20008435 CACACACACACACTTATTCCAGG + Intergenic
1177957484 21:27617263-27617285 CCCCCACCCACACTTCTTCCTGG - Intergenic
1178279780 21:31271557-31271579 TCCCCACCCCCAATTCTTCCTGG + Intronic
1180136172 21:45863395-45863417 CACCCACCCCTTCCTATTCCAGG + Intronic
1181047494 22:20222577-20222599 CAGCCACCCCCATTTTATTCAGG - Intergenic
1183010605 22:34943601-34943623 CACCCAGCCCCATTTTATGCAGG - Intergenic
1183349375 22:37326170-37326192 CAGCCACACCCACTTATTTCTGG + Intergenic
1183732776 22:39627929-39627951 CACCCAGCCCCACCTCTTCCAGG - Intronic
1183780576 22:39996087-39996109 CCCCGTCCCCCATTCATTCCAGG - Intronic
1184912975 22:47548363-47548385 CACCCAACACCATTTATTAAAGG - Intergenic
950264841 3:11565865-11565887 CACCCTCCCTGCTTTATTCCAGG + Intronic
952610793 3:35206485-35206507 CACCCACTCCCATTCCTACCAGG + Intergenic
954976933 3:54704886-54704908 CCCCCACCCCCATTTCTACAGGG + Intronic
956126154 3:66012898-66012920 CACCCATCCCCATTTCCTCTAGG + Intronic
962743180 3:138378094-138378116 CAGCCACACCCACTTCTTCCTGG - Intronic
963480232 3:145863608-145863630 CACCCATCCCCAGTTATTCAGGG + Intergenic
965437789 3:168673816-168673838 CACCCACACCCATTTCTTAGGGG + Intergenic
965679196 3:171233037-171233059 CACCCACATACATTTATTTCTGG + Intronic
967803333 3:193689324-193689346 CTCCTACCCCCATTACTTCCTGG + Intronic
968720501 4:2199457-2199479 CACCCACCCCCTTTTATCACTGG - Intronic
969144907 4:5114135-5114157 CAACCACCCCCATTCTCTCCAGG + Intronic
970191564 4:13523588-13523610 CCCCCACCCCCATTAATTGCTGG + Intergenic
970364578 4:15345432-15345454 CACCGACCCCCAGTCTTTCCAGG + Intronic
970816547 4:20162641-20162663 CCCCCCCACCCCTTTATTCCTGG - Intergenic
977284714 4:95088341-95088363 TACCCACCCCCAACTATGCCAGG - Intronic
978155738 4:105487956-105487978 AACCCAGCCACATTTCTTCCAGG + Intergenic
980963936 4:139502498-139502520 CACCCACCCCCTTGCAGTCCAGG - Intronic
983588798 4:169384732-169384754 CACCCTCCCCTTTTAATTCCAGG + Intergenic
988509938 5:31856272-31856294 GACCCACCCACAGTTAATCCAGG + Intronic
992008390 5:72501867-72501889 CACCCCCACCCATTTGTTCATGG - Intronic
992902842 5:81316236-81316258 CAACCATCGCCATTAATTCCAGG + Intergenic
997846727 5:137293183-137293205 CACACAGCACCATTTATTTCAGG + Intronic
1004776453 6:18851433-18851455 GACCCACCGCCATTAGTTCCGGG + Intergenic
1005159495 6:22842797-22842819 CACAAACCTCCCTTTATTCCAGG - Intergenic
1006667263 6:35704472-35704494 CAGCCACCCAGATATATTCCTGG - Intronic
1007258341 6:40544259-40544281 CACCCATTCCCATTGATGCCAGG + Intronic
1008184627 6:48373642-48373664 CACCCACCCACATTCGTCCCAGG - Intergenic
1009548351 6:65052187-65052209 TACCCAACCCCATTTAGTTCTGG + Intronic
1009890920 6:69680829-69680851 CACTCCCCTCCATTTATTCAGGG - Intronic
1010251623 6:73713341-73713363 CACCCACCCCTATTTCTTGCTGG - Intronic
1011402684 6:86980876-86980898 CACCCACCCACACATACTCCTGG - Intronic
1012300261 6:97578560-97578582 CACCCACACACATATATTCAAGG + Intergenic
1015960198 6:138640779-138640801 CCCCCACCCCCAGTTGTTCAAGG + Intronic
1017010187 6:150058101-150058123 CCCCCACCCCCAGTTAGTCAGGG + Intergenic
1017394996 6:153988406-153988428 CCACCACACCCATTTATTACCGG + Intergenic
1018202152 6:161405150-161405172 CACCCACTGCCATTTGTTCCTGG - Intronic
1022107981 7:27210430-27210452 CTCCCACCCCCATCCAATCCAGG + Intergenic
1025112146 7:56227014-56227036 TACCCACCCACATTCATCCCCGG + Intergenic
1029150741 7:98478588-98478610 CCCCCACCCCGATTTAGACCTGG - Intergenic
1030337599 7:108342952-108342974 AACCCAGCCACATTTCTTCCAGG + Intronic
1031264856 7:119569315-119569337 AACCCAGCCACATTTCTTCCAGG + Intergenic
1032632917 7:133673068-133673090 CACCCCTCCCCAGTTCTTCCAGG + Intronic
1033127431 7:138718188-138718210 CACACACACCCATTCCTTCCTGG - Intronic
1033127440 7:138718264-138718286 CACACACCGCCATTCCTTCCTGG - Intronic
1033141208 7:138828487-138828509 CACCCACCCCCATTTATTCCAGG + Intronic
1034312416 7:150100368-150100390 CACACAACCCCATCTATTGCTGG + Intergenic
1034794436 7:154000296-154000318 CACACAACCCCATCTATTGCTGG - Intronic
1035553288 8:545416-545438 CGCCGACCCCCACTTACTCCCGG + Intronic
1036171396 8:6488990-6489012 CTCCCACCCAAATTTTTTCCTGG + Intronic
1038194295 8:25352344-25352366 CACCCAGCCCCTTTGATTCAAGG + Intronic
1038524657 8:28262688-28262710 CACCCATACCCCTTTCTTCCAGG - Intergenic
1039519438 8:38158011-38158033 CCCTCACCCCCATGTTTTCCTGG + Intergenic
1039769688 8:40672299-40672321 CACACACACCCCTCTATTCCTGG - Intronic
1042685160 8:71430695-71430717 CACCCACCCCCATTGGTTTCAGG - Intronic
1049095994 8:140548468-140548490 GACCCACCCCCCGCTATTCCTGG + Intronic
1052632824 9:31062412-31062434 TACCCACCACCATATCTTCCAGG + Intergenic
1054762066 9:69012824-69012846 CACCCCCCCCCATGCCTTCCTGG - Exonic
1057466165 9:95316923-95316945 CGCCCTCCGCCTTTTATTCCCGG - Intronic
1057855803 9:98599840-98599862 TACCCACCCCCATCTCTCCCTGG - Intronic
1058668936 9:107344386-107344408 AACCCAGCCCCATAGATTCCTGG + Intergenic
1060555806 9:124506713-124506735 CACCCACCCCCACAGGTTCCAGG + Intronic
1185884999 X:3774590-3774612 CATCCATCCCCACTTCTTCCTGG - Intergenic
1186693313 X:12003059-12003081 AGCACACCCCCATTCATTCCAGG + Intergenic
1188170457 X:26918175-26918197 CACACACACACATCTATTCCTGG - Intergenic
1190738257 X:53269914-53269936 ACCCCGCCCCCATTTCTTCCTGG + Intronic
1192778298 X:74267843-74267865 CTCCCAACCCCATTGGTTCCAGG + Intergenic
1192879989 X:75273837-75273859 CTGCCACCCCCAGTTTTTCCTGG + Intergenic
1197784328 X:130185656-130185678 CCCCCACCCCCATTCTTTCTTGG + Intergenic
1198231424 X:134693150-134693172 TGCCCACCCCCATGTATTTCAGG + Intronic
1201611767 Y:15851205-15851227 CACCCACCCCCATTTTTTTTTGG + Intergenic