ID: 1033142583

View in Genome Browser
Species Human (GRCh38)
Location 7:138840724-138840746
Sequence ATGGGCTGGTAGAAGTGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 100}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033142583_1033142593 19 Left 1033142583 7:138840724-138840746 CCTGCGCACTTCTACCAGCCCAT 0: 1
1: 0
2: 0
3: 4
4: 100
Right 1033142593 7:138840766-138840788 TCTCCTGAAACACTGTGTGAGGG 0: 1
1: 0
2: 3
3: 10
4: 221
1033142583_1033142592 18 Left 1033142583 7:138840724-138840746 CCTGCGCACTTCTACCAGCCCAT 0: 1
1: 0
2: 0
3: 4
4: 100
Right 1033142592 7:138840765-138840787 CTCTCCTGAAACACTGTGTGAGG No data
1033142583_1033142586 -8 Left 1033142583 7:138840724-138840746 CCTGCGCACTTCTACCAGCCCAT 0: 1
1: 0
2: 0
3: 4
4: 100
Right 1033142586 7:138840739-138840761 CAGCCCATCAGAAAGCCCACGGG No data
1033142583_1033142585 -9 Left 1033142583 7:138840724-138840746 CCTGCGCACTTCTACCAGCCCAT 0: 1
1: 0
2: 0
3: 4
4: 100
Right 1033142585 7:138840738-138840760 CCAGCCCATCAGAAAGCCCACGG 0: 1
1: 0
2: 3
3: 23
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033142583 Original CRISPR ATGGGCTGGTAGAAGTGCGC AGG (reversed) Intronic
900842668 1:5067110-5067132 ATGGGCTGGCAGAATGGGGCAGG + Intergenic
901614754 1:10529772-10529794 TTCCGCTGGTAGAAGTGCACAGG - Intronic
912112680 1:106363039-106363061 ATGTGCTGGTAGAAGTACACAGG - Intergenic
918121405 1:181544284-181544306 AAAGGCTGGTAGAAGTGAGGTGG + Intronic
920116884 1:203627770-203627792 GTGGGCTGGGAGAAGTTGGCAGG + Intronic
1065359131 10:24872560-24872582 ATGGCCTGTTAGAATTGCCCTGG - Intronic
1065826625 10:29578423-29578445 ATCTGCTGGAAGAAGTGAGCAGG - Intronic
1067838861 10:49660107-49660129 ATGGGAGAGTAGAAGTGTGCTGG + Intronic
1075979840 10:126728467-126728489 AAGGGCTTGTGGAAGTGGGCTGG + Intergenic
1076821477 10:132942140-132942162 CTGGGCTGGGAGAAGTGAGCCGG + Intronic
1077866881 11:6229736-6229758 ATGGGATTGTAGAACTGCGGTGG - Intronic
1082768814 11:57189762-57189784 ATGGGCTGATAGAATACCGCTGG - Exonic
1084756498 11:71242218-71242240 AGGGGCTGGGAGAAGGGGGCTGG + Intronic
1095369385 12:41448526-41448548 ATGGGATGGTAGAACTGCATAGG - Intronic
1095529339 12:43166837-43166859 ATGGTCTGGTGGAAGTGCTTTGG + Intergenic
1097981760 12:65742582-65742604 CTGGGCTGGTAGAAGCTCCCGGG - Intergenic
1098172096 12:67757480-67757502 AAGGGCTGGAAGGAGTGCACTGG - Intergenic
1103147784 12:118610467-118610489 GTGGGCTGGTGGAAGAGTGCTGG + Intergenic
1105210105 13:18252618-18252640 AAGGGCTGGTGGAGGTGGGCTGG - Intergenic
1110210329 13:72964377-72964399 ATGGGCTGATGGAAGTGTTCTGG + Intronic
1121634729 14:95446242-95446264 ATGAGCTGGCAGGAATGCGCTGG + Intronic
1122388183 14:101362964-101362986 GTGGGCTGGGAGAAGTGGGTAGG - Intergenic
1123134849 14:106018177-106018199 ATTGGCAGGTAGCAGTGGGCAGG + Intergenic
1125223714 15:37369998-37370020 ATAGGCTGGTACAAGTGTCCAGG + Intergenic
1128247804 15:66144686-66144708 CGGGGCTGGTACAAGTGCCCTGG + Intronic
1129525052 15:76208524-76208546 ATGGGCTGGAGGAAGGGCTCTGG - Intronic
1131706875 15:95006318-95006340 ATGGGGTGGGAGGAGTGGGCAGG - Intergenic
1132414909 15:101612975-101612997 AGGGTCTGGTAGAAGTGCTGTGG + Intergenic
1137746027 16:50820728-50820750 ATGGGCTGGTGGAAATGGGAAGG + Intergenic
1142104350 16:88294304-88294326 ATGGTGTGTTAGAAGTGCACAGG - Intergenic
1143874598 17:9982070-9982092 ATGGGATGGTGGAAGGGGGCAGG - Intronic
1145991940 17:29084715-29084737 ATGGGCTGGTGGCAGCGCACAGG - Intronic
1146142198 17:30378131-30378153 ATGAGGTGGGAGAAGTGGGCCGG + Intergenic
1146941664 17:36847687-36847709 ATTGGCTGGGTGAAGTGGGCAGG - Intergenic
1147509832 17:41058465-41058487 ATGGGCAGGTAGATATGCCCAGG + Intergenic
1155407684 18:25507201-25507223 AAGGGCTGGAAGTAGTGCCCCGG + Intergenic
1157761154 18:50266523-50266545 AGGGGCCGGTAGAGGTGGGCGGG + Intergenic
1160308148 18:77760570-77760592 ATAGGCTGGGTGAAGTGAGCTGG + Intergenic
1161589742 19:5123980-5124002 ATGGGCTGGCAGGGGTGGGCTGG + Intronic
1163634425 19:18431629-18431651 AAGGGCTGGAAGAGGTGGGCGGG - Exonic
1163786573 19:19277776-19277798 ATGGGCTGGAAGGAGGGCGAGGG - Exonic
1166356214 19:42229089-42229111 ATGGGGTGGTAGAAGGGTGAGGG + Intergenic
1166753329 19:45175631-45175653 ATGGGCTGGGAGAAGGGAGCAGG + Intronic
1167058457 19:47128331-47128353 ATTGGTTGGTTGAAGTGTGCAGG + Intronic
1167943082 19:52963000-52963022 TTGGGCTGGGAGGAGTCCGCGGG + Intergenic
925640572 2:5982671-5982693 ATGGGCTGCTCGATGGGCGCCGG - Intergenic
932180674 2:69643592-69643614 CGGGGCTGGTAGCAGGGCGCCGG - Exonic
932779988 2:74553895-74553917 AAGGGCTGGGAGAAGAGTGCTGG + Exonic
935738502 2:106126086-106126108 ATGGGCAGTTAGAAGAGCCCAGG - Intronic
943137793 2:183937544-183937566 AGGTGCTGGTAGCAGTGGGCAGG - Intergenic
1169270172 20:4193035-4193057 ATTGCCTGGTAGAAGTTCACAGG + Intergenic
1171291251 20:23984308-23984330 AAGGGCTGGTGGAGGTGGGCTGG - Intergenic
1175902369 20:62365068-62365090 ATCAGCTGGTAGACGTGAGCTGG - Intronic
1179146294 21:38770898-38770920 ATGGGCAGGTGGAGGTGTGCAGG - Intergenic
1180766152 22:18346786-18346808 AAGGGCTGGTGGAGGTGGGCTGG + Intergenic
1180780161 22:18515592-18515614 AAGGGCTGGTGGAGGTGGGCTGG - Intergenic
1180812877 22:18772913-18772935 AAGGGCTGGTGGAGGTGGGCTGG - Intergenic
1181199035 22:21207161-21207183 AAGGGCTGGTGGAGGTGGGCTGG - Intergenic
1181199055 22:21207229-21207251 AAGGGCTGGTGGAGGTGGGCTGG - Intergenic
1181400709 22:22648627-22648649 AAGGGCTGGTGGAGGTGGGCTGG + Intergenic
1181702689 22:24629725-24629747 AAGGGCTGGTGGAGGTGGGCTGG + Intergenic
1183991003 22:41597042-41597064 CTGGGCTGGTGGGAGTGCGTTGG + Intergenic
1184775555 22:46621090-46621112 ATGGGCAGCTAGAAGTGGGGAGG + Intronic
1203227770 22_KI270731v1_random:87677-87699 AAGGGCTGGTGGAGGTGGGCTGG + Intergenic
949454396 3:4223615-4223637 ATGGGCTGGAAGAAGAGAGGAGG - Intronic
950474138 3:13205173-13205195 ATGGGGTGGGAGATGTGCGCTGG - Intergenic
950666795 3:14501240-14501262 TTGGGGTGTTAGAAGTGCTCTGG + Intronic
952949206 3:38505562-38505584 ATAGGCTGGTATAAGTGCAGTGG - Intronic
953912972 3:46902056-46902078 AGGGCCTGGTACAAGTGGGCAGG - Intronic
954343829 3:49979310-49979332 TTGGGCTGATAGAAGTGTTCTGG + Intronic
954421546 3:50421574-50421596 ATGGGGTGGGAGGAGTGCCCTGG - Intronic
954429031 3:50459469-50459491 ATGGGGTGGGAGGAGTGCCCTGG - Intronic
961199594 3:125033716-125033738 ATGGACTGGTAGCGGTCCGCGGG + Intronic
961513947 3:127421236-127421258 ATAGGCTGGTAGAGATGTGCTGG - Intergenic
962898594 3:139737421-139737443 ATGGGCTGGCAGAGGAGGGCAGG + Intergenic
968740845 4:2331030-2331052 ATGGGCTGGAAGGAGGGGGCTGG + Intronic
968740863 4:2331079-2331101 ATGGGCTGGAAGGAGGGGGCTGG + Intronic
969301400 4:6299394-6299416 ATGGGGAGGTAGGGGTGCGCTGG + Intronic
969868995 4:10093279-10093301 ATGAGCTGGTAGAAGGGGACAGG + Intronic
980022852 4:127730262-127730284 CTCCGCTCGTAGAAGTGCGCAGG + Intergenic
984140658 4:176001280-176001302 CTTGGCTGGAAGAAGTGAGCGGG + Intronic
989781717 5:45273914-45273936 TTTGGCTGGTAGAAGTACTCTGG + Intronic
990603751 5:57386638-57386660 ATGGTCTGGTGGCAGTGGGCTGG - Intergenic
996442722 5:123510518-123510540 ATGGGCTGGTCTAAGTACGGTGG - Intergenic
997203004 5:132024073-132024095 ATGGCCTGGAAGAAGAGAGCAGG - Intergenic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
999689810 5:154136975-154136997 CTGGGCTGGTTGAAGGGAGCAGG - Intronic
1008146161 6:47894076-47894098 ATGGGCTGATAGAACTCAGCTGG - Intronic
1008307298 6:49918850-49918872 ATGAGCTGGTGGAAGTGTGATGG - Intergenic
1018392669 6:163352427-163352449 CTGGGCGGGTGGAAGTGGGCAGG - Intergenic
1018443507 6:163834543-163834565 ATGGCCTGGCAGAGGGGCGCCGG + Intergenic
1024279714 7:47709371-47709393 ATGGGCAGATAGAGGTGGGCAGG + Intronic
1027509161 7:79057578-79057600 AAGGGCTGAGAGAAGTGTGCAGG - Intronic
1027744043 7:82050938-82050960 ATGGACTGGTAGAATTGCATAGG - Intronic
1028213537 7:88104034-88104056 ATATACTGATAGAAGTGCGCAGG + Intronic
1033142583 7:138840724-138840746 ATGGGCTGGTAGAAGTGCGCAGG - Intronic
1037841585 8:22248973-22248995 AAGGGCTGGTAACAGTGAGCTGG + Intronic
1040981535 8:53250865-53250887 ATGGCCGGGGAGATGTGCGCGGG + Exonic
1048183423 8:132216850-132216872 ATGGGCAAGAAGAAGTGTGCTGG + Intronic
1051671012 9:19510735-19510757 ATGATCTGGTAGAAGTGCTTTGG + Exonic
1057144547 9:92749225-92749247 ATAGGCTGGCAGAGGTGGGCGGG - Intronic
1061281577 9:129600724-129600746 GTGGGCTGGGACAAGTGCCCAGG + Intergenic
1188221495 X:27546558-27546580 ATGTCCTGGTAGAAGTCTGCTGG - Intergenic
1193221061 X:78927826-78927848 ATGGCCTGGTAGAGTTGAGCTGG + Intergenic
1201405069 Y:13641810-13641832 ATAGTCTGGTAGAATTGGGCTGG + Intergenic