ID: 1033146127

View in Genome Browser
Species Human (GRCh38)
Location 7:138871276-138871298
Sequence CAGGATCTCCCGCCCCCCGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 116}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033146127_1033146134 30 Left 1033146127 7:138871276-138871298 CCTCCGGGGGGCGGGAGATCCTG 0: 1
1: 0
2: 1
3: 6
4: 116
Right 1033146134 7:138871329-138871351 TGCTGCTCATTTCCCGAACTGGG 0: 1
1: 0
2: 0
3: 7
4: 160
1033146127_1033146133 29 Left 1033146127 7:138871276-138871298 CCTCCGGGGGGCGGGAGATCCTG 0: 1
1: 0
2: 1
3: 6
4: 116
Right 1033146133 7:138871328-138871350 GTGCTGCTCATTTCCCGAACTGG 0: 1
1: 0
2: 1
3: 11
4: 250
1033146127_1033146131 -1 Left 1033146127 7:138871276-138871298 CCTCCGGGGGGCGGGAGATCCTG 0: 1
1: 0
2: 1
3: 6
4: 116
Right 1033146131 7:138871298-138871320 GTCCACGTGCTCGAAGATGGAGG 0: 1
1: 0
2: 0
3: 2
4: 59
1033146127_1033146130 -4 Left 1033146127 7:138871276-138871298 CCTCCGGGGGGCGGGAGATCCTG 0: 1
1: 0
2: 1
3: 6
4: 116
Right 1033146130 7:138871295-138871317 CCTGTCCACGTGCTCGAAGATGG 0: 1
1: 0
2: 0
3: 7
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033146127 Original CRISPR CAGGATCTCCCGCCCCCCGG AGG (reversed) Exonic
900558912 1:3294048-3294070 CAGGAACGCCTGGCCCCCGGGGG - Intronic
901057877 1:6457218-6457240 CAGGAGGTCCCGCCTCCAGGCGG - Exonic
901229015 1:7631666-7631688 CAGGATCTGCCGGCCCCTGCAGG - Intronic
901657261 1:10776623-10776645 CAGGAGCTCCCGCCCCTAGCTGG - Intronic
902873186 1:19326344-19326366 CAGGAGCGCCCGCCCCCGGAAGG - Exonic
902875600 1:19338988-19339010 CAGACTCTCCCGTCCCACGGAGG - Exonic
903581213 1:24372463-24372485 CAGGATCCCCCCACCCCGGGAGG + Intronic
904236630 1:29121344-29121366 CAGGCGCTCCGGCCCCCCGACGG - Exonic
908918112 1:69157106-69157128 CAGGATCTCAAGCCCCTGGGTGG + Intergenic
914796194 1:150922608-150922630 CAGGTTCTCCCTCCTCCCAGAGG + Intergenic
914917154 1:151825893-151825915 CAGGCTCCCCCGCCCCCAGGTGG + Intronic
920118393 1:203637353-203637375 CAGGCTCCGCCCCCCCCCGGGGG - Intronic
922287576 1:224183395-224183417 CAGGATCTCCCGGCGCCGGTCGG - Exonic
923612018 1:235504273-235504295 CGGGCTCTCCCGCGTCCCGGCGG + Exonic
1063208393 10:3856148-3856170 GAGGATCTCTTGCCCCCAGGAGG + Intergenic
1068538598 10:58267772-58267794 GAGGAGCGCCCGCGCCCCGGCGG - Exonic
1076166568 10:128286937-128286959 GAGGAGCCCCCGCCCGCCGGCGG + Intergenic
1076264416 10:129098692-129098714 CAGGACCTCCCGCCCTCAAGGGG + Intergenic
1076606118 10:131691103-131691125 CAGGATCCCACGCCCCACTGAGG + Intergenic
1077110808 11:861252-861274 CAGGAGCACCTGCCACCCGGAGG - Intronic
1077492743 11:2869738-2869760 CAGGCTCTCCCGCCGTCCCGGGG + Intergenic
1083902242 11:65649304-65649326 CAGGATCTGGGGCCCCCCGCCGG - Exonic
1092138541 12:6166963-6166985 CAGCATCTCCCACCCCACGCTGG + Intergenic
1093459939 12:19398789-19398811 CAGGAGCTTACCCCCCCCGGGGG + Intergenic
1095947052 12:47759308-47759330 CAGGGTCTCCAGCCGCCCGGGGG + Intronic
1096469852 12:51869223-51869245 CTGGAGCTCCCGCCCCTCGGTGG + Intergenic
1101875139 12:108592459-108592481 CAGGCTCACCAGCCCCCAGGAGG + Intronic
1104912295 12:132245108-132245130 CAGGCTCCCCTGCCCCGCGGAGG + Intronic
1114485317 14:23058200-23058222 GAGGAGCTGCCGCCCCCTGGTGG + Intergenic
1119899403 14:78247121-78247143 CATTATCTCCAGCCCCCCTGCGG + Intronic
1121737069 14:96225953-96225975 CAGCCTCTCCAGCCCCCTGGTGG - Intronic
1122370260 14:101225594-101225616 CAGGGTCCCACGGCCCCCGGGGG - Intergenic
1123067295 14:105625142-105625164 CATGATCTCCCGGACCCCTGAGG - Intergenic
1123071317 14:105643869-105643891 CATGATCTCCCGGACCCCTGAGG - Intergenic
1123076271 14:105668909-105668931 CATGATCTCCCGGACCCCTGAGG - Intergenic
1123090972 14:105742139-105742161 CATGATCTCCCGGACCCCTGAGG - Intergenic
1125835356 15:42745924-42745946 CAGGATCTTCCTCCTCCAGGAGG - Exonic
1134069957 16:11254906-11254928 CAGGTTCTCGCGGCCCACGGTGG + Exonic
1138331319 16:56218132-56218154 GAGGATCTCTCGCCCACCTGGGG - Intronic
1142711837 17:1727709-1727731 CAGGATCTCCAGGCCCTCAGGGG - Exonic
1143299560 17:5899585-5899607 CAGGCTCTCCCCCTCCCCGAGGG - Intronic
1147156701 17:38547784-38547806 CAGGACCTGGGGCCCCCCGGGGG - Intronic
1148059872 17:44829522-44829544 CTGGAACTCCTGCCTCCCGGGGG - Intronic
1151578472 17:74964389-74964411 CAGGGCCTCCCGCCCCACAGGGG - Intronic
1151656829 17:75500117-75500139 CAGGGTCTGCCCACCCCCGGCGG + Intergenic
1151751275 17:76039673-76039695 CAGAATCTCCCCCGCCCCCGAGG + Exonic
1152390591 17:80001682-80001704 CAGGAGCTGCCGCCACCCAGGGG - Intronic
1152663001 17:81551684-81551706 CAGGATCCCGCGCCCCGCCGTGG + Intronic
1156608524 18:38698125-38698147 CAGGACCTCCCCTCCCCCGATGG - Intergenic
1161169220 19:2804716-2804738 CAGGATCTCCTGCCCCAGAGAGG - Intronic
1162951778 19:14075236-14075258 CAGGTCCTACCGCCCCCTGGCGG + Intergenic
1163690380 19:18735406-18735428 CAGGATCCCCCGCTCCCCGGGGG - Intronic
1164960887 19:32428516-32428538 CAGGATCCCCCGCATCCCAGTGG - Intronic
1165100707 19:33436898-33436920 CAAGATCTCCCTCCTCCCTGTGG - Intronic
1166305695 19:41935862-41935884 CAGGCTCCCCCCCCACCCGGCGG + Intergenic
1167056225 19:47112855-47112877 CCGGGTGTCCCGCCCCCCGGGGG - Intronic
1167313954 19:48753119-48753141 CAGGTTCTCCATCCCCCAGGAGG - Exonic
1168257373 19:55174146-55174168 CAGGATGCCCCGCCCCCAAGCGG - Intronic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
926925070 2:17978950-17978972 CAGGGTCTCCAGCCCACCTGAGG - Intronic
931780687 2:65577022-65577044 CAGGATCTCCAGCCCAGTGGGGG - Intergenic
932345914 2:70994981-70995003 CAGGATCCCCCGCTCCACTGAGG + Exonic
932469445 2:71944380-71944402 CAGGACCTCAGGCCTCCCGGGGG - Intergenic
933851980 2:86375478-86375500 CAGGATCTCTTGACCCCGGGGGG - Intergenic
1169077056 20:2767784-2767806 CAGGACCTCCCACCCTCCTGAGG - Intergenic
1171071346 20:22071264-22071286 AAGGATCTCCCCTCCCCCGCTGG + Intergenic
1176135086 20:63519063-63519085 CAGGGTCTCCCGTCCCTGGGCGG + Intergenic
1176181443 20:63751665-63751687 CATGAAGCCCCGCCCCCCGGTGG + Intronic
1176181469 20:63751725-63751747 CATGAAGCCCCGCCCCCCGGTGG + Intronic
1176181482 20:63751754-63751776 CATGAAGCCCCGCCCCCCGGTGG + Intronic
1176181509 20:63751813-63751835 CATGAAGCCCCGCCCCCCGGTGG + Intronic
1176181522 20:63751842-63751864 CATGAAGCCCCGCCCCCCGGTGG + Intronic
1182526138 22:30921386-30921408 AAGCGTCTCCCGCCCCCAGGTGG - Intergenic
1183131259 22:35838994-35839016 CTGGCTCTCTCGCCCTCCGGTGG + Intronic
1183607132 22:38872363-38872385 CAGGACCTCCCCCTCCCCCGGGG + Intergenic
1184045237 22:41969086-41969108 CAGGAACTCCAGCCCCCTTGAGG + Intergenic
1184507934 22:44915537-44915559 CAGGCTCTCCCGCCCACTGAGGG - Intronic
950733887 3:14989201-14989223 CAGGAGCTCCCTCCCCTCAGTGG + Intronic
950940202 3:16884447-16884469 GAGGATCTCCCGGCCCCGGGCGG - Intronic
951908754 3:27728651-27728673 CAGTATCTCCCGCCACCCGCTGG + Intergenic
963259071 3:143176113-143176135 CAGGAGACCCCGGCCCCCGGCGG - Intergenic
969032594 4:4226727-4226749 CGGAATCCCCGGCCCCCCGGCGG - Exonic
969337030 4:6517090-6517112 CAGGGTCTCCCTCCCGCCTGGGG - Intronic
970161820 4:13196959-13196981 CAGGCTCTCCCTCCCCAGGGTGG + Intergenic
970460619 4:16271112-16271134 CATCATCTCCTGCCCCCAGGAGG + Intergenic
970637137 4:18021832-18021854 CCGGAGCGCGCGCCCCCCGGAGG + Exonic
971087512 4:23296037-23296059 CAGCCTCTCCAGCCTCCCGGTGG - Intergenic
979547273 4:121951969-121951991 GAGGCTCTCCAGCCCCGCGGCGG + Intergenic
984735100 4:183100129-183100151 AAGGGGCTCCCGCCCCCCGCCGG + Intronic
987114050 5:14712813-14712835 CAGGTTCTCCTGCACCCAGGAGG + Intronic
989396191 5:40959541-40959563 CAGGATCTCCCACCCCCACTGGG - Exonic
991674176 5:69075463-69075485 CAGGAGCTCCTGCCCCACCGAGG - Intergenic
1002596694 5:180328425-180328447 CAGGACCTCCCGCCATCAGGAGG - Intronic
1006187684 6:32190106-32190128 CAGGAGACCCCGGCCCCCGGCGG + Exonic
1007614277 6:43171366-43171388 CAGCAGCCCCTGCCCCCCGGGGG + Exonic
1010161110 6:72856894-72856916 CTGCATCTCCAGCCCCACGGGGG - Intronic
1019147564 6:169984860-169984882 CAGGGTCTCCCACCGCCCAGAGG - Intergenic
1020279288 7:6642300-6642322 CAGGGTCTCCCGCAGCCTGGCGG - Intronic
1022120447 7:27303073-27303095 CAGGATCCCTGGCTCCCCGGTGG + Intergenic
1027138259 7:75639360-75639382 CGGGATTTCCCGGTCCCCGGGGG - Intronic
1028922376 7:96322166-96322188 CTGGATCACGCGCACCCCGGCGG - Intergenic
1031075663 7:117210082-117210104 TAGGTTCTCCCATCCCCCGGTGG + Intronic
1031886928 7:127253142-127253164 CAGAGGCTCCCGCCCCTCGGGGG - Exonic
1033146127 7:138871276-138871298 CAGGATCTCCCGCCCCCCGGAGG - Exonic
1034245284 7:149639178-149639200 CAGGATCTCAGCCACCCCGGGGG + Intergenic
1034324659 7:150219974-150219996 TAGGATCTCCAGCCCCAGGGTGG + Intergenic
1034768533 7:153749257-153749279 TAGGATCTCCAGCCCCAGGGTGG - Intergenic
1035018648 7:155787680-155787702 GAGGCTCTCCTGCCCCGCGGAGG + Intergenic
1037926467 8:22847468-22847490 CAGGATCTCCTGTCCCTTGGGGG - Intronic
1041693629 8:60714176-60714198 GGGGATGCCCCGCCCCCCGGGGG - Intronic
1047381856 8:124372021-124372043 CTGGCGCTCGCGCCCCCCGGCGG - Exonic
1049162065 8:141103933-141103955 CAGGGTCTCCGGCCTCCCCGAGG - Intergenic
1049578888 8:143401828-143401850 CAGGATGCCCCGCCCGCTGGGGG - Intergenic
1059271270 9:113071646-113071668 CAGGAACCCGGGCCCCCCGGTGG - Intergenic
1059307552 9:113366695-113366717 CAGGAGCTCCCGCCAACAGGTGG - Intronic
1059345585 9:113625759-113625781 CAGGAGCTCAGGCCCCCCAGAGG + Intergenic
1060246127 9:121947796-121947818 CAGGATCTCCAGTACCCCCGCGG + Intronic
1061050404 9:128191607-128191629 CTGGACCTCCCGTCCCCCAGAGG - Intronic
1061985632 9:134128756-134128778 GAGGATCACCTGCACCCCGGGGG + Intergenic
1062069766 9:134549402-134549424 CCGGATCTCCCGCTTCCCGAGGG - Intergenic
1062392213 9:136338360-136338382 CAGGACCCCCCGTCCCCCTGGGG + Intronic
1062489964 9:136800236-136800258 CCGCAAGTCCCGCCCCCCGGTGG - Intronic
1062625942 9:137441563-137441585 CAGGGTCGCCCCGCCCCCGGGGG + Intronic
1197798887 X:130328561-130328583 CCTGATCTCCCCACCCCCGGGGG + Intergenic