ID: 1033146127

View in Genome Browser
Species Human (GRCh38)
Location 7:138871276-138871298
Sequence CAGGATCTCCCGCCCCCCGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 116}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033146127_1033146131 -1 Left 1033146127 7:138871276-138871298 CCTCCGGGGGGCGGGAGATCCTG 0: 1
1: 0
2: 1
3: 6
4: 116
Right 1033146131 7:138871298-138871320 GTCCACGTGCTCGAAGATGGAGG 0: 1
1: 0
2: 0
3: 2
4: 59
1033146127_1033146133 29 Left 1033146127 7:138871276-138871298 CCTCCGGGGGGCGGGAGATCCTG 0: 1
1: 0
2: 1
3: 6
4: 116
Right 1033146133 7:138871328-138871350 GTGCTGCTCATTTCCCGAACTGG 0: 1
1: 0
2: 1
3: 11
4: 250
1033146127_1033146130 -4 Left 1033146127 7:138871276-138871298 CCTCCGGGGGGCGGGAGATCCTG 0: 1
1: 0
2: 1
3: 6
4: 116
Right 1033146130 7:138871295-138871317 CCTGTCCACGTGCTCGAAGATGG 0: 1
1: 0
2: 0
3: 7
4: 47
1033146127_1033146134 30 Left 1033146127 7:138871276-138871298 CCTCCGGGGGGCGGGAGATCCTG 0: 1
1: 0
2: 1
3: 6
4: 116
Right 1033146134 7:138871329-138871351 TGCTGCTCATTTCCCGAACTGGG 0: 1
1: 0
2: 0
3: 7
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033146127 Original CRISPR CAGGATCTCCCGCCCCCCGG AGG (reversed) Exonic