ID: 1033146130

View in Genome Browser
Species Human (GRCh38)
Location 7:138871295-138871317
Sequence CCTGTCCACGTGCTCGAAGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 47}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033146127_1033146130 -4 Left 1033146127 7:138871276-138871298 CCTCCGGGGGGCGGGAGATCCTG 0: 1
1: 0
2: 1
3: 6
4: 116
Right 1033146130 7:138871295-138871317 CCTGTCCACGTGCTCGAAGATGG 0: 1
1: 0
2: 0
3: 7
4: 47
1033146121_1033146130 8 Left 1033146121 7:138871264-138871286 CCCGCCGGCTAGCCTCCGGGGGG 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1033146130 7:138871295-138871317 CCTGTCCACGTGCTCGAAGATGG 0: 1
1: 0
2: 0
3: 7
4: 47
1033146123_1033146130 7 Left 1033146123 7:138871265-138871287 CCGCCGGCTAGCCTCCGGGGGGC 0: 1
1: 0
2: 0
3: 7
4: 63
Right 1033146130 7:138871295-138871317 CCTGTCCACGTGCTCGAAGATGG 0: 1
1: 0
2: 0
3: 7
4: 47
1033146125_1033146130 4 Left 1033146125 7:138871268-138871290 CCGGCTAGCCTCCGGGGGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 110
Right 1033146130 7:138871295-138871317 CCTGTCCACGTGCTCGAAGATGG 0: 1
1: 0
2: 0
3: 7
4: 47
1033146128_1033146130 -7 Left 1033146128 7:138871279-138871301 CCGGGGGGCGGGAGATCCTGTCC 0: 1
1: 0
2: 0
3: 8
4: 171
Right 1033146130 7:138871295-138871317 CCTGTCCACGTGCTCGAAGATGG 0: 1
1: 0
2: 0
3: 7
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033146130 Original CRISPR CCTGTCCACGTGCTCGAAGA TGG Exonic