ID: 1033146134

View in Genome Browser
Species Human (GRCh38)
Location 7:138871329-138871351
Sequence TGCTGCTCATTTCCCGAACT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 160}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033146127_1033146134 30 Left 1033146127 7:138871276-138871298 CCTCCGGGGGGCGGGAGATCCTG 0: 1
1: 0
2: 1
3: 6
4: 116
Right 1033146134 7:138871329-138871351 TGCTGCTCATTTCCCGAACTGGG 0: 1
1: 0
2: 0
3: 7
4: 160
1033146128_1033146134 27 Left 1033146128 7:138871279-138871301 CCGGGGGGCGGGAGATCCTGTCC 0: 1
1: 0
2: 0
3: 8
4: 171
Right 1033146134 7:138871329-138871351 TGCTGCTCATTTCCCGAACTGGG 0: 1
1: 0
2: 0
3: 7
4: 160
1033146132_1033146134 6 Left 1033146132 7:138871300-138871322 CCACGTGCTCGAAGATGGAGGCT 0: 1
1: 0
2: 0
3: 2
4: 73
Right 1033146134 7:138871329-138871351 TGCTGCTCATTTCCCGAACTGGG 0: 1
1: 0
2: 0
3: 7
4: 160
1033146129_1033146134 11 Left 1033146129 7:138871295-138871317 CCTGTCCACGTGCTCGAAGATGG 0: 1
1: 0
2: 0
3: 5
4: 32
Right 1033146134 7:138871329-138871351 TGCTGCTCATTTCCCGAACTGGG 0: 1
1: 0
2: 0
3: 7
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033146134 Original CRISPR TGCTGCTCATTTCCCGAACT GGG Exonic