ID: 1033147348

View in Genome Browser
Species Human (GRCh38)
Location 7:138882876-138882898
Sequence CAGGCTCAGGGGTCTGTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 290}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033147348_1033147355 -6 Left 1033147348 7:138882876-138882898 CCCATGACAGACCCCTGAGCCTG 0: 1
1: 0
2: 2
3: 21
4: 290
Right 1033147355 7:138882893-138882915 AGCCTGCAACTAGGGATGCCAGG No data
1033147348_1033147358 15 Left 1033147348 7:138882876-138882898 CCCATGACAGACCCCTGAGCCTG 0: 1
1: 0
2: 2
3: 21
4: 290
Right 1033147358 7:138882914-138882936 GGCCTCAGCTTCTAGAGCTGTGG 0: 1
1: 0
2: 1
3: 23
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033147348 Original CRISPR CAGGCTCAGGGGTCTGTCAT GGG (reversed) Intronic
904833162 1:33318572-33318594 CAGGGTCAGGAGGCTGTTATAGG - Intronic
906295891 1:44648928-44648950 CTGGCTCAGGGGTCTGGAAAAGG + Intronic
907328628 1:53657206-53657228 GAGGCTCAGGTGTATGTAATGGG + Intronic
910384140 1:86663427-86663449 CATGCACAGGGGCCTGTCTTGGG + Intergenic
911170300 1:94764431-94764453 CACACACAGGGGCCTGTCATGGG + Intergenic
912456528 1:109802085-109802107 CAGGATCAGGGCTCAGTCAGAGG - Intergenic
912594524 1:110860654-110860676 CACACACAGGGGCCTGTCATGGG - Intergenic
913584541 1:120261093-120261115 CACGCACAGGGGCCTGTCAGGGG + Intergenic
913623643 1:120637266-120637288 CACGCACAGGGGCCTGTCAGGGG - Intergenic
913687785 1:121249747-121249769 CACACACAGGGGCCTGTCATGGG - Intronic
914039643 1:144037387-144037409 CACACACAGGGGCCTGTCATGGG - Intergenic
914149813 1:145030533-145030555 CACACACAGGGGCCTGTCATGGG + Intronic
914566538 1:148872949-148872971 CACGCACAGGGGCCTGTCAGGGG + Intronic
914606281 1:149257291-149257313 CACGCACAGGGGCCTGTCAGGGG - Intergenic
915296420 1:154924838-154924860 CAGGCTGAGGGGACTGGCACTGG + Exonic
916648036 1:166807446-166807468 CAGGTTCAGGTGTCTGACAAGGG + Intergenic
917209464 1:172616646-172616668 CAGGGTCAGGGGTCTTTCCATGG + Intergenic
918889842 1:190252941-190252963 CACACCCTGGGGTCTGTCATGGG - Intronic
919602445 1:199638826-199638848 CACACACTGGGGTCTGTCATGGG + Intergenic
920294096 1:204945422-204945444 CAGGACCAGGGGTCTGGCTTTGG - Intronic
920475109 1:206268245-206268267 CACACACAGGGGCCTGTCATGGG - Intronic
922862915 1:228834693-228834715 CAGGCTCAGGGGACACTCCTTGG + Intergenic
1065075477 10:22074496-22074518 CACACACAGGGGTCTGTCAGAGG - Intergenic
1065229871 10:23587049-23587071 CACACACAGGGGCCTGTCATGGG - Intergenic
1066599405 10:37088442-37088464 CACACTCTGGGGCCTGTCATGGG - Intergenic
1068366726 10:56060516-56060538 CACACACTGGGGTCTGTCATGGG - Intergenic
1068378108 10:56211490-56211512 CACTCACTGGGGTCTGTCATGGG + Intergenic
1068960554 10:62862798-62862820 GAGGCTCTGGGGTCTGTCTCAGG - Intronic
1069609036 10:69760000-69760022 CGGGCTCAGGTGGCTGTCAGTGG - Intergenic
1071731501 10:88253212-88253234 GAGTCTCAGGGGTCTGTCTCTGG + Intergenic
1072576013 10:96700959-96700981 CAGGCCCTGTGGTCTGTTATAGG - Intronic
1072657730 10:97342119-97342141 CAGGCTTAGGGGACTGACAGAGG + Intergenic
1072760849 10:98055284-98055306 TAAAATCAGGGGTCTGTCATGGG + Intergenic
1074258229 10:111825653-111825675 CATTCTCTGGGGCCTGTCATGGG - Intergenic
1074280231 10:112044570-112044592 CACACACTGGGGTCTGTCATGGG + Intergenic
1074467070 10:113692663-113692685 CAAACTCAGTAGTCTGTCATAGG - Intronic
1075684342 10:124353432-124353454 CAGGATGAGGAGCCTGTCATGGG - Intergenic
1076672247 10:132129661-132129683 CAGGCTCAGGGATCTGCCTGTGG + Intronic
1076976676 11:177566-177588 CAGGCTAAGGGCTCAGTCCTAGG + Intronic
1077095130 11:795943-795965 CAGCCTCAGGGGCCTCCCATAGG + Intronic
1077458811 11:2698687-2698709 CAGGGTCTGGAGTCTGTCTTTGG - Intronic
1078036934 11:7815572-7815594 CATACACAGGGGCCTGTCATGGG + Intergenic
1078313123 11:10266341-10266363 CAGTCTCAGTGCTCTGTCCTTGG - Intronic
1078360358 11:10663087-10663109 CAGGCCCAGAGATCTGTCAAGGG + Intronic
1080085934 11:28282191-28282213 GTGGCACAGGGGTCTGTCAAAGG - Intronic
1081774973 11:45670662-45670684 CAGGGTCGGGGGCCTGTCTTTGG - Intergenic
1082701944 11:56442718-56442740 CAGCCTGAGGGCTGTGTCATGGG - Intergenic
1086028086 11:82319189-82319211 CATGCACAGGGGCCTGTCAGGGG + Intergenic
1089441766 11:118523482-118523504 CAGGTTCAGGACTCTGTCTTGGG - Exonic
1090353399 11:126122457-126122479 CAGGAAGAGGGGTATGTCATCGG - Intergenic
1090489356 11:127144583-127144605 CTGGCTCTGGGGTGTGGCATAGG - Intergenic
1090537350 11:127657969-127657991 AAGACTCAGGGGTCTCTCAAAGG - Intergenic
1090687667 11:129141453-129141475 CAGACACCGGGGCCTGTCATGGG + Intronic
1093128388 12:15358214-15358236 CACACTCTGGGGCCTGTCATGGG + Intronic
1094740161 12:33279822-33279844 CAGGCTCAGAAGTCTGAAATAGG - Intergenic
1094804792 12:34079037-34079059 CACACTCAGGGGCCTGTCATGGG + Intergenic
1095077735 12:37952814-37952836 CACGCTCAGGGGACTGTTGTGGG + Intergenic
1096228789 12:49886008-49886030 CAGGCTGAGGGGGCTGAAATGGG - Intronic
1096525447 12:52207468-52207490 CAGGCTCAGGGGAGGGTCTTTGG + Intergenic
1097183558 12:57184479-57184501 CTGGGTCAGGGGTCTACCATCGG - Intronic
1099701773 12:86093015-86093037 CACACACAGGGGTCTGTCAAGGG - Intronic
1101845882 12:108362690-108362712 AAGGCTCATAGGGCTGTCATGGG + Intergenic
1103370539 12:120415910-120415932 CAGGCTCAGGGCTCAATAATGGG + Intergenic
1103713128 12:122928038-122928060 CAGGTTCAGGGGTTTGACAAGGG - Intronic
1105350614 13:19611910-19611932 CACGCTCCGGGGCCTGTCATGGG - Intergenic
1106654072 13:31723528-31723550 CACACACTGGGGTCTGTCATGGG - Intergenic
1106802180 13:33267475-33267497 CAGGCTCTGAGGAATGTCATAGG - Intronic
1106964878 13:35051202-35051224 CAGGTTCAGGGTTCTTTCTTGGG + Intronic
1107008970 13:35648841-35648863 CACGCACTGGGGCCTGTCATGGG + Intronic
1110224239 13:73103130-73103152 CAGGCTCATGGGTTTCTAATTGG + Intergenic
1111723525 13:91976102-91976124 CACGCTCTGGGGACTGTTATGGG + Intronic
1113630408 13:111879071-111879093 CACACACTGGGGTCTGTCATGGG - Intergenic
1114073724 14:19137628-19137650 CAGGTTCAGGGTTCTTTCTTGGG + Intergenic
1114088540 14:19262357-19262379 CAGGTTCAGGGTTCTTTCTTGGG - Intergenic
1114904142 14:27103449-27103471 CATGCACTGGGGCCTGTCATGGG - Intergenic
1116219176 14:42060201-42060223 CACACTCCGGGGCCTGTCATGGG - Intergenic
1116914459 14:50509213-50509235 CACACACAGGGGCCTGTCATGGG + Intronic
1121835498 14:97088610-97088632 CAGGGTCAGGGGTGTTTCATAGG + Intergenic
1123017837 14:105384052-105384074 CTGGCTCAGGGCTCTGACGTCGG - Intronic
1123507718 15:20961455-20961477 CAGGTTCTGGGGACTATCATGGG + Intergenic
1123564939 15:21535195-21535217 CAGGTTCTGGGGACTATCATGGG + Intergenic
1123601199 15:21972489-21972511 CAGGTTCTGGGGACTATCATGGG + Intergenic
1125167131 15:36720437-36720459 CACACTCTGGGGCCTGTCATAGG - Intronic
1125717749 15:41828692-41828714 CAGGCTCATGTGTATGTGATGGG + Intronic
1127718435 15:61674625-61674647 CAGGACCAGGGGCCAGTCATAGG - Intergenic
1128293489 15:66497388-66497410 GAGGCTCAGGGATCTGTGTTTGG - Intronic
1128718179 15:69925498-69925520 CAGGCTCAGGGCCTTGTCTTTGG + Intergenic
1128765317 15:70247790-70247812 CAGGCCCAGGGGTGTGACATGGG - Intergenic
1129225558 15:74168504-74168526 CAGGATCTGGGGTCTGGAATGGG - Intergenic
1129737531 15:77974553-77974575 CAGGGCCAGGGGCCTGTCACTGG + Intergenic
1130047039 15:80453656-80453678 CAGGAGCAGGGGCCTGCCATGGG - Intronic
1130253383 15:82314880-82314902 CAGAGTCAGGGGCCTGTCACTGG + Intergenic
1132028275 15:98420897-98420919 CAGTCTCAGGGGTAGGGCATGGG + Intergenic
1132390231 15:101433456-101433478 CTGGCTCTGGGGCCTGACATGGG + Intronic
1202973307 15_KI270727v1_random:262308-262330 CAGGTTCTGGGGACTATCATGGG + Intergenic
1133165283 16:3942516-3942538 CACACACTGGGGTCTGTCATGGG + Intergenic
1133231571 16:4369460-4369482 CAGGTCCAGGGGTCTGTCCCAGG + Intronic
1134482982 16:14634212-14634234 CCGGCTCGGGGGTGTGTCCTGGG - Intronic
1134853110 16:17498182-17498204 CAGGCTCAGGGGTATGTATCAGG - Intergenic
1136292791 16:29285779-29285801 CAGGGTCAGGGGTCTCTCCCTGG - Intergenic
1136576771 16:31129972-31129994 CAGGCTCAGGGGGCAGGCACAGG - Intronic
1136579155 16:31141644-31141666 GGGGCTCAGGGGTCAGCCATGGG - Intronic
1137412664 16:48242877-48242899 CACACTCAGGGGCCTGTCGTTGG + Intronic
1137463695 16:48689020-48689042 GACGCTCAGGAGTCTGTGATGGG + Intergenic
1137809098 16:51335774-51335796 CACACACAGGGGCCTGTCATGGG + Intergenic
1137972499 16:53000139-53000161 CACACACCGGGGTCTGTCATGGG + Intergenic
1139951841 16:70676237-70676259 CAGGATCAGGGGCCTTTCCTTGG - Intronic
1140062362 16:71581897-71581919 CAGGCCAAGGGGTGTGTGATGGG + Intergenic
1140293031 16:73681666-73681688 CAGGATCAGGTGCCTGTCTTTGG - Intergenic
1140425035 16:74853849-74853871 CATGCACTGGGGCCTGTCATGGG - Intergenic
1140881401 16:79201095-79201117 GAGGCTCAGTGGCTTGTCATAGG + Intronic
1141170382 16:81687138-81687160 CAGGCCCCAGGCTCTGTCATTGG + Intronic
1142098680 16:88259783-88259805 CAGGGTCAGGGGTCTCTCCCTGG - Intergenic
1142149089 16:88504885-88504907 CAGGCCCAGTGGCCTGTCCTGGG - Intronic
1142443736 16:90120608-90120630 CAGGCTAAGGGCTCAGTCCTAGG - Intergenic
1143417318 17:6759253-6759275 CAGGCTTATGGATCTGGCATAGG + Intronic
1144440329 17:15275608-15275630 CACGCACCGGGGCCTGTCATGGG - Intergenic
1145766652 17:27462457-27462479 CAGCCTCAGGGTTCGGGCATGGG + Intronic
1148197264 17:45723016-45723038 AAGGATAAGGGGTCTGTCACAGG - Intergenic
1149054866 17:52351431-52351453 CACACACAGGGGCCTGTCATGGG - Intergenic
1149399130 17:56276026-56276048 CACACTCTGGGGCCTGTCATGGG - Intronic
1150797194 17:68247924-68247946 CACGCTCAGGGGCGTGGCATGGG + Exonic
1152584310 17:81182197-81182219 CAGGCTCAGGGGTCTGGGCCGGG + Intergenic
1153500918 18:5749001-5749023 CCCGCTCCAGGGTCTGTCATAGG - Intergenic
1157142826 18:45128026-45128048 CACACACAGGGGTCTGTCATTGG - Intergenic
1159423575 18:68254239-68254261 CACACACAGGGGCCTGTCATGGG + Intergenic
1159617490 18:70598496-70598518 CAGGCTTCTGGGTCTGTGATGGG - Intergenic
1161064214 19:2229589-2229611 CAGGCTCCCTGGTCTGTCACGGG + Intronic
1161277154 19:3424948-3424970 CAGGCCCTGGGGTCTCTCTTTGG - Intronic
1163738308 19:18995326-18995348 CTGGATCAAGGGTCTGTCCTAGG + Intronic
1163940513 19:20488394-20488416 CACACCCTGGGGTCTGTCATGGG + Intergenic
1164664096 19:30011879-30011901 CACACACCGGGGTCTGTCATGGG + Intronic
1166449153 19:42882566-42882588 CAGGCTAAGGTGTTTGTTATAGG - Intronic
1167377023 19:49117824-49117846 CAGGCTCAGCTGTCTGTGTTGGG + Intronic
926383739 2:12315994-12316016 CAACCTCAGGGTACTGTCATTGG - Intergenic
929250532 2:39749766-39749788 CACACACAGGGGTCTGTCAGGGG - Intronic
929591921 2:43153208-43153230 CAGACTCAAGTGTCTGTCTTTGG - Intergenic
929961094 2:46496838-46496860 CAGGCTCCGGGGTCAGCGATGGG + Intronic
932426521 2:71640072-71640094 CACGCTCAGTGGTGTGACATTGG - Intronic
932560830 2:72867345-72867367 CATGCACAGCTGTCTGTCATGGG - Intergenic
932912333 2:75818577-75818599 TAGGCTCTGGGGTCTGTAATGGG + Intergenic
935304726 2:101726344-101726366 CAGGCTAAGTGGTCTGTCATGGG + Intronic
936116844 2:109709525-109709547 CAGGCTCAGTGGTCTGTCTAGGG - Intergenic
936492886 2:112989126-112989148 CAGGCACTGGGGCCTGTCAGGGG + Intergenic
936564893 2:113575397-113575419 CAGGCTCTGGGCTGTGTCACTGG + Intergenic
936610273 2:113995824-113995846 CACACACTGGGGTCTGTCATGGG - Intergenic
936926686 2:117744150-117744172 CATGCACCGGGGCCTGTCATGGG - Intergenic
937567399 2:123311382-123311404 CACACACAGGGGTCTGTCAGGGG + Intergenic
938396817 2:130956799-130956821 CACACTCAGGGGACTGTCGTGGG + Intronic
938487663 2:131729013-131729035 CAGGTTCAGGGTTCTTTCTTGGG + Intronic
938716280 2:134024786-134024808 CAGGCTGTGGGGACTGTCTTGGG - Intergenic
940620505 2:156107045-156107067 CACACACAGGGGCCTGTCATGGG + Intergenic
940643907 2:156370423-156370445 CACACTCCGGGGCCTGTCATGGG - Intergenic
941508493 2:166376409-166376431 CAGACTCAGGGCTTTGCCATTGG - Intergenic
942073089 2:172332796-172332818 CAGGCTTAGGGGTATGTTATGGG + Intergenic
942854262 2:180526875-180526897 CACACTCTGGGGCCTGTCATGGG - Intergenic
943245445 2:185443624-185443646 CAGGTGCAGTGGTCAGTCATTGG + Intergenic
945012575 2:205480952-205480974 CAGCCCCAGGAGTCTGTCATTGG - Intronic
945162246 2:206904653-206904675 CACCCACTGGGGTCTGTCATGGG - Intergenic
947751437 2:232534839-232534861 GAGGCCCAGGGGTCTCTCCTAGG - Intronic
1169634853 20:7678142-7678164 CACACACTGGGGTCTGTCATGGG + Intergenic
1169903050 20:10572083-10572105 CTGTCTCAGGGATCTGCCATGGG - Intronic
1172870022 20:38130045-38130067 CAGGCTCAGGAGGCTGAGATGGG + Exonic
1173359718 20:42331732-42331754 CACACTCAGAGGTCTATCATGGG - Intronic
1174161490 20:48554060-48554082 CATGGTCTGAGGTCTGTCATAGG - Intergenic
1175246090 20:57582963-57582985 CAGGCTGAGGGGTCTGGGGTGGG + Intergenic
1175528998 20:59661329-59661351 CAGACTCATGGGCCTGTCGTTGG - Intronic
1175751032 20:61498038-61498060 CACACACAGGGGCCTGTCATGGG + Intronic
1175803357 20:61813618-61813640 CTGGCTCAGGGCTGTGTAATGGG + Intronic
1175814795 20:61877818-61877840 GGGGCTCAGGGGACGGTCATGGG + Intronic
1175940942 20:62537311-62537333 CAGGCCCTGGGGGCTGTCGTTGG + Intergenic
1180492171 22:15859980-15860002 CAGGTTCAGGGTTCTTTCTTGGG + Intergenic
1180594885 22:16966575-16966597 CAGCCTCAGGGGTCAGACTTTGG + Intronic
1180723404 22:17926445-17926467 GATGCTCAGGGCTCTGTCCTTGG + Intronic
1180800702 22:18630595-18630617 CTGGCTCAGGGGTCTGTGTGGGG - Intergenic
1180851934 22:19026152-19026174 CTGGCTCAGGGGTCTGTGTGGGG - Intergenic
1181221017 22:21364667-21364689 CTGGCTCAGGGGTCTGTGTGGGG + Intergenic
1181235519 22:21445827-21445849 CAGGCTCAGGTGGTTGTCCTCGG - Exonic
1181421704 22:22803709-22803731 CTGCCTCAGGGGACTGTCATGGG + Intronic
1181535607 22:23541435-23541457 CAGGCTGATGTTTCTGTCATCGG + Intergenic
1183521886 22:38300437-38300459 CAGGCTCAGAGGTTTAACATGGG - Intronic
1183739852 22:39663458-39663480 CAGGCTCAGGGATCTGGGCTGGG + Intronic
1184087976 22:42276966-42276988 CTGGCTCAGAAGTCTGTCAGTGG + Intronic
1184255933 22:43287025-43287047 CAGGCACAAGGGTGTGTGATGGG + Intronic
1184648732 22:45910010-45910032 CACGCCCCGGGGTCTGTCACTGG + Intergenic
1185038538 22:48491770-48491792 CAGGCTCAGATGTCTGTGCTGGG - Intronic
949485436 3:4533327-4533349 CAGGCTCTGGAGTCAGTCATGGG + Intronic
952752752 3:36838636-36838658 CATGCTCAGGGCAGTGTCATGGG + Exonic
954001797 3:47563491-47563513 CAGGTTCAGGAGTTTGTCAGAGG - Intronic
954264774 3:49463561-49463583 CTGGCTCAGGGGTCAATCAGGGG + Intergenic
954315963 3:49802023-49802045 AAGGCCCAGGTGTCTGTGATTGG - Intergenic
955854785 3:63261547-63261569 CACACTCTGGGGACTGTCATGGG + Intronic
956111249 3:65871640-65871662 CAGGCTCAGGGATCCGGCTTAGG + Intronic
956244314 3:67164448-67164470 CACACACTGGGGTCTGTCATGGG + Intergenic
956552233 3:70474279-70474301 CAGTCACAGGGGCCAGTCATGGG - Intergenic
958725801 3:97904898-97904920 CACACTCTGGGGACTGTCATGGG - Intronic
961336713 3:126184684-126184706 CTGGCTCAGGGCTCTGTGAATGG + Intronic
961376407 3:126468924-126468946 CAGCCCCAGGGCTCTGTCCTAGG + Intronic
961386691 3:126526823-126526845 GAGACCCAGGGGTCTGCCATTGG - Intronic
961459688 3:127042563-127042585 CCGGCTCAGGGGTCTTTCTCTGG + Intergenic
962075069 3:132073009-132073031 CAGACACTGGGGCCTGTCATGGG + Intronic
962774548 3:138647031-138647053 CACACACTGGGGTCTGTCATGGG - Intergenic
963588656 3:147227992-147228014 CACACTCAGGGGCCTGTCATGGG - Intergenic
963713869 3:148780798-148780820 CACACACAGGGGCCTGTCATGGG - Intergenic
964394573 3:156231936-156231958 CAGGCTGAGGGCTGTGTCATGGG + Intronic
964947524 3:162244295-162244317 CATGCACTGGGGCCTGTCATGGG - Intergenic
965088129 3:164125895-164125917 CACACACAGGGGCCTGTCATGGG - Intergenic
967928783 3:194674888-194674910 GAGACTCAGTTGTCTGTCATCGG - Intergenic
968364031 3:198171656-198171678 CAGGCTAAGGGCTCAGTCCTAGG - Intergenic
971312336 4:25536189-25536211 CAGGCTCAGGGCAGTGTCAAGGG - Intergenic
972785770 4:42325600-42325622 CACACACAGGGGCCTGTCATGGG + Intergenic
972964797 4:44496556-44496578 CACGCACTGGGGCCTGTCATGGG - Intergenic
973875315 4:55212065-55212087 CACACACAGGGGCCTGTCATAGG + Intergenic
975998691 4:80345434-80345456 CACACACCGGGGTCTGTCATGGG - Intronic
979415567 4:120434216-120434238 CACACTCTGGGGACTGTCATGGG - Intergenic
982792502 4:159609572-159609594 CACACACCGGGGTCTGTCATGGG - Intergenic
985017589 4:185652481-185652503 GAGGCACAGGGATCTGTCACCGG + Intronic
987884823 5:23800089-23800111 CAGGCTTCTGGGTCTGTGATGGG - Intergenic
988093378 5:26569809-26569831 CAGGCTCCGGGGTCTCTCTGGGG + Intergenic
988840696 5:35081022-35081044 CACACACAGGGGCCTGTCATGGG + Intronic
990659301 5:57995457-57995479 GAGTCTCAGGGGTTTGCCATTGG - Intergenic
990935490 5:61143710-61143732 AAGGCTCAGGAGTCAGTCTTAGG - Intronic
991274633 5:64830180-64830202 CACACACAGGGGCCTGTCATGGG - Intronic
992597927 5:78364865-78364887 CACACACCGGGGTCTGTCATGGG + Intronic
993296358 5:86146404-86146426 CACGCACCGGGGCCTGTCATGGG - Intergenic
995178612 5:109208664-109208686 CACACTCTGGGGCCTGTCATGGG - Intergenic
995208088 5:109505061-109505083 CACACACTGGGGTCTGTCATGGG + Intergenic
995575050 5:113520923-113520945 CAGGCACTGGGGTCTATCAGAGG - Intronic
997017873 5:129958450-129958472 CAGGCTTGGGGGTCAATCATTGG - Intronic
997026366 5:130066836-130066858 CAGGATCCGGGGTCTGTCATAGG + Intronic
997415619 5:133726162-133726184 CAGGCACAGGAGTCAGGCATAGG - Intergenic
998323623 5:141257845-141257867 CACACACAGGGGCCTGTCATGGG - Intergenic
998910097 5:146950380-146950402 CAGGCTCTGTGCTCTGTCTTTGG - Intronic
999047240 5:148482490-148482512 CAGGGTCAGAGATCTGTCAGAGG - Exonic
1000122616 5:158211637-158211659 CACACACTGGGGTCTGTCATGGG + Intergenic
1000167434 5:158666836-158666858 CATGCACCGGGGCCTGTCATCGG - Intergenic
1000816327 5:165927125-165927147 CAGGGTGAGGGGGGTGTCATTGG - Intergenic
1001071854 5:168592707-168592729 CACACACAGGGGCCTGTCATGGG - Intergenic
1001160766 5:169310796-169310818 CACACCCTGGGGTCTGTCATGGG - Intergenic
1001421905 5:171593951-171593973 CAGGCTCAAGGGTCTGAGACAGG - Intergenic
1001521727 5:172398809-172398831 AAGCCTCAGGGGTCAGTCCTGGG - Intronic
1001899236 5:175410032-175410054 CACACACAGGGGCCTGTCATGGG + Intergenic
1003369651 6:5511857-5511879 CAGGTTCAGGAGTCTGTTAGAGG + Intronic
1003996707 6:11548905-11548927 CACACACTGGGGTCTGTCATGGG + Intronic
1005503410 6:26449849-26449871 CAGGGTCAGGAGTCTCTCAGAGG - Intronic
1005870499 6:29971444-29971466 CAGGTTCAGGCTTCTGTCAGAGG + Intergenic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006072288 6:31506648-31506670 CAGGCTCAGGCTTCTGTCAGAGG - Intronic
1006098665 6:31672032-31672054 CAGGGCCAGGGGCCTGTCATGGG - Exonic
1008580678 6:52903931-52903953 CATGCTCATGGGTCTGACAATGG + Intronic
1011349827 6:86410261-86410283 CATGCACTGGGGCCTGTCATGGG - Intergenic
1011525462 6:88259590-88259612 CACACACCGGGGTCTGTCATGGG + Intergenic
1011856580 6:91700451-91700473 CAGAGTCAGGGATCTGTCACAGG + Intergenic
1012963440 6:105647030-105647052 CAGGTTCAGGGGTCTGTGAGTGG - Intergenic
1013819911 6:114142441-114142463 CAGGCTCACGAGTGAGTCATGGG + Intronic
1015861261 6:137682676-137682698 CACACACAGGGGCCTGTCATGGG - Intergenic
1016355072 6:143209683-143209705 CAAGGTCAGGAGTCTGACATGGG - Intronic
1017303232 6:152886484-152886506 CACACACAGGGGCCTGTCATGGG + Intergenic
1018651451 6:165994943-165994965 CAGGTTGAGGGGACTCTCATTGG - Intergenic
1019251786 7:18007-18029 CAGGCTAAGGGCTCAGTCCTAGG + Intergenic
1019665818 7:2251970-2251992 CAGGTTTAGGGCTCTGACATGGG - Exonic
1021321611 7:19219430-19219452 CAGACACTGGGGCCTGTCATGGG + Intergenic
1021804440 7:24341170-24341192 CAGGCTCAGCAGTCTGACTTTGG - Intergenic
1023873501 7:44275047-44275069 CAGGGTCAGGGGCTTGTCAGTGG - Intronic
1027823965 7:83087049-83087071 CACGCACTGGGGCCTGTCATAGG + Intronic
1029269990 7:99371569-99371591 CAGGCACCGGGCTCTGTCATGGG + Intronic
1029459809 7:100688091-100688113 CAGGCTCAGGGCCCTGTCCGGGG - Exonic
1030204366 7:106938470-106938492 CACACACCGGGGTCTGTCATGGG + Intergenic
1033147348 7:138882876-138882898 CAGGCTCAGGGGTCTGTCATGGG - Intronic
1034208379 7:149339570-149339592 CACACACCGGGGTCTGTCATGGG - Intergenic
1035564938 8:635192-635214 GAGGCTGAGGGGCCTGTCCTCGG - Intronic
1035660108 8:1341193-1341215 CATGCGCAGGTGTCTTTCATAGG - Intergenic
1035735443 8:1883931-1883953 CTGGCTCAGGGGCCTGGCATGGG - Intronic
1036072831 8:5461003-5461025 CACACTCTGGGGACTGTCATGGG - Intergenic
1036074225 8:5476724-5476746 CAGACTCAGTGGTCTGTCTGAGG - Intergenic
1038040003 8:23716466-23716488 CATGCACGGGGGCCTGTCATGGG - Intergenic
1038413236 8:27374562-27374584 CAGGCTCTGGGCTCTCACATAGG + Intronic
1041745911 8:61209223-61209245 CAGGCTCAGGGGCCAATCTTTGG + Intronic
1041759974 8:61355574-61355596 CAGGCTCTGGGGACTGTTGTGGG - Intronic
1048584764 8:135764686-135764708 CAGGCACAGGGCTCTGTGCTGGG + Intergenic
1049249230 8:141579305-141579327 CAGAATCAGGGCTCTGTCAGTGG - Intergenic
1049676505 8:143891585-143891607 CAGGCTACAGGGTCTGTCCTGGG - Intergenic
1049721212 8:144116317-144116339 CTGGCTCTGGGGCCTGTCATTGG + Exonic
1050173229 9:2844012-2844034 CAGGCTCAGCGGTCGCTCTTGGG - Intronic
1050860507 9:10423286-10423308 CACACTCTGGGGTCTGTCATGGG + Intronic
1051394189 9:16601598-16601620 CAGGCTCAGGAGTGTGTAGTAGG - Intronic
1052982180 9:34457848-34457870 CAGGCCCAGGGGTCTGGGATGGG - Intronic
1055261945 9:74447286-74447308 CAGGCCCAGGGATTTGTCTTAGG + Intergenic
1055287140 9:74740939-74740961 GAGGCTCTGGGGTATGACATTGG - Intronic
1056722711 9:89085447-89085469 CTGCCTCAGGGATCTGGCATGGG - Intronic
1057220218 9:93253476-93253498 CAGGCCCAGGGCACTGTCAGTGG - Intronic
1059166200 9:112078577-112078599 CAGTCTCCGGGCTCTGTCTTCGG - Exonic
1060124424 9:121028675-121028697 CACACTCTGGGGCCTGTCATGGG + Intronic
1060559547 9:124531537-124531559 CAGGCTGTGGAGTCTGTAATTGG - Intronic
1061717458 9:132529338-132529360 CACACTCTGGGGACTGTCATGGG + Intronic
1062348928 9:136129381-136129403 ACGGCTCAGGGGTCCGTCAGTGG - Intergenic
1062748726 9:138235602-138235624 CAGGCTAAGGGCTCAGTCCTAGG - Intergenic
1186441516 X:9591044-9591066 CTGGCTCTGGGATCTGTCCTGGG - Intronic
1189637861 X:43031407-43031429 CACGCACTGGGGCCTGTCATGGG + Intergenic
1189737641 X:44087794-44087816 CACACTCTGGGGACTGTCATGGG - Intergenic
1191973895 X:66849125-66849147 CACACACAGGGGCCTGTCATGGG - Intergenic
1192633366 X:72793664-72793686 GATGCCCAGGGGTCTGTCAAGGG + Intronic
1192648343 X:72927137-72927159 GATGCCCAGGGGTCTGTCAAGGG - Intronic
1192929776 X:75793607-75793629 CACACTCCGGGGCCTGTCATGGG - Intergenic
1193225177 X:78974118-78974140 CACACCCAGGGGCCTGTCATGGG - Intergenic
1195047433 X:101066879-101066901 CACACCCTGGGGTCTGTCATGGG + Intergenic
1195368344 X:104148664-104148686 CACACACAGGGGCCTGTCATGGG + Intronic
1195593139 X:106655501-106655523 CAAGCACTGGGGCCTGTCATGGG - Intronic
1195666215 X:107433529-107433551 CACACACTGGGGTCTGTCATGGG - Intergenic
1195728720 X:107943724-107943746 CACACACAGGGGCCTGTCATGGG - Intergenic
1195808947 X:108808052-108808074 CACACACAGGGGCCTGTCATAGG - Intergenic
1198790164 X:140336561-140336583 CACACACCGGGGTCTGTCATGGG + Intergenic
1199700841 X:150374448-150374470 CAGGCTCAGGGCACACTCATGGG + Intronic
1200771530 Y:7129977-7129999 CACACACTGGGGTCTGTCATCGG - Intergenic