ID: 1033147787

View in Genome Browser
Species Human (GRCh38)
Location 7:138885861-138885883
Sequence CTGGAGACCTACACTTGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033147782_1033147787 27 Left 1033147782 7:138885811-138885833 CCAAAAAGCGATGGTGGGAACCT 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1033147787 7:138885861-138885883 CTGGAGACCTACACTTGTGATGG No data
1033147784_1033147787 7 Left 1033147784 7:138885831-138885853 CCTCAACTTGAAGCCAGTCGGTC 0: 4
1: 57
2: 86
3: 157
4: 265
Right 1033147787 7:138885861-138885883 CTGGAGACCTACACTTGTGATGG No data
1033147786_1033147787 -6 Left 1033147786 7:138885844-138885866 CCAGTCGGTCAGAAGTTCTGGAG 0: 6
1: 29
2: 51
3: 126
4: 242
Right 1033147787 7:138885861-138885883 CTGGAGACCTACACTTGTGATGG No data
1033147781_1033147787 28 Left 1033147781 7:138885810-138885832 CCCAAAAAGCGATGGTGGGAACC 0: 1
1: 0
2: 0
3: 9
4: 90
Right 1033147787 7:138885861-138885883 CTGGAGACCTACACTTGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033147787 Original CRISPR CTGGAGACCTACACTTGTGA TGG Intronic
No off target data available for this crispr