ID: 1033148025

View in Genome Browser
Species Human (GRCh38)
Location 7:138887864-138887886
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033148021_1033148025 25 Left 1033148021 7:138887816-138887838 CCACGTTGGGAAACTGTGAACTT 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1033148025 7:138887864-138887886 CAGCAGCAGCAGCAGCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr