ID: 1033148973

View in Genome Browser
Species Human (GRCh38)
Location 7:138896745-138896767
Sequence ATAAGCTAGCTGGGCATGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2306
Summary {0: 1, 1: 1, 2: 43, 3: 617, 4: 1644}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033148973_1033148981 22 Left 1033148973 7:138896745-138896767 CCCACCATGCCCAGCTAGCTTAT 0: 1
1: 1
2: 43
3: 617
4: 1644
Right 1033148981 7:138896790-138896812 GGGGTCTTGCTATGTTTCCCAGG 0: 120
1: 2679
2: 11549
3: 46698
4: 133589
1033148973_1033148982 26 Left 1033148973 7:138896745-138896767 CCCACCATGCCCAGCTAGCTTAT 0: 1
1: 1
2: 43
3: 617
4: 1644
Right 1033148982 7:138896794-138896816 TCTTGCTATGTTTCCCAGGCTGG 0: 276
1: 6988
2: 44516
3: 140480
4: 241443
1033148973_1033148978 1 Left 1033148973 7:138896745-138896767 CCCACCATGCCCAGCTAGCTTAT 0: 1
1: 1
2: 43
3: 617
4: 1644
Right 1033148978 7:138896769-138896791 ATTATTATTATTTGTAGAGATGG 0: 51
1: 140
2: 1751
3: 5803
4: 30608
1033148973_1033148979 2 Left 1033148973 7:138896745-138896767 CCCACCATGCCCAGCTAGCTTAT 0: 1
1: 1
2: 43
3: 617
4: 1644
Right 1033148979 7:138896770-138896792 TTATTATTATTTGTAGAGATGGG 0: 54
1: 231
2: 2307
3: 18211
4: 144397
1033148973_1033148980 3 Left 1033148973 7:138896745-138896767 CCCACCATGCCCAGCTAGCTTAT 0: 1
1: 1
2: 43
3: 617
4: 1644
Right 1033148980 7:138896771-138896793 TATTATTATTTGTAGAGATGGGG 0: 47
1: 245
2: 2614
3: 17519
4: 132425

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033148973 Original CRISPR ATAAGCTAGCTGGGCATGGT GGG (reversed) Intronic
Too many off-targets to display for this crispr