ID: 1033149280

View in Genome Browser
Species Human (GRCh38)
Location 7:138899261-138899283
Sequence TCAGGGGCCCAGAATCACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 211}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033149274_1033149280 2 Left 1033149274 7:138899236-138899258 CCTCATAATAAGCTCCGTAAGCC 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1033149280 7:138899261-138899283 TCAGGGGCCCAGAATCACCATGG 0: 1
1: 0
2: 1
3: 12
4: 211
1033149273_1033149280 7 Left 1033149273 7:138899231-138899253 CCAATCCTCATAATAAGCTCCGT 0: 1
1: 0
2: 1
3: 2
4: 52
Right 1033149280 7:138899261-138899283 TCAGGGGCCCAGAATCACCATGG 0: 1
1: 0
2: 1
3: 12
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033149280 Original CRISPR TCAGGGGCCCAGAATCACCA TGG Intronic
900326429 1:2110682-2110704 GCAGAGGCCCACAGTCACCAAGG - Intronic
900845997 1:5101360-5101382 CCAAGGACCCAGAATCACCCAGG + Intergenic
900929707 1:5728897-5728919 GCAGGGGCCCTGGCTCACCAGGG + Intergenic
901880150 1:12189022-12189044 TCACAGGCCCAGAAGCAGCAGGG - Intronic
902375889 1:16029796-16029818 TCAGGACCCCAGACTCACCAAGG - Exonic
904890179 1:33773796-33773818 AGAGGGGCCCAGAGTCATCAGGG + Intronic
912403292 1:109414659-109414681 TCAAGCTCCCAGAGTCACCATGG + Intronic
912701888 1:111884174-111884196 TCAGAGCCCCAGGATCCCCAAGG - Intronic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
919825488 1:201500380-201500402 TCAGGGGCCCACATCCAGCAGGG + Intronic
920113917 1:203606462-203606484 TCAGGGTTCCAGAATTCCCAGGG - Intergenic
921557065 1:216611686-216611708 TCAAGGGCCCAGAATCTACCGGG + Intronic
922806107 1:228390764-228390786 TCAGGAGTCCAGCATCACCCTGG + Intergenic
924156501 1:241182122-241182144 TCAAGGACCCAGAATTAGCACGG - Intronic
924413741 1:243835268-243835290 TCTGGGGACCAAAATCACCCTGG + Intronic
1064215569 10:13397399-13397421 TCAAGAGCCCTGGATCACCAGGG + Intergenic
1064320848 10:14303272-14303294 TAACGTGCACAGAATCACCAGGG + Intronic
1064978411 10:21142660-21142682 TCAGGGGCCCCCAACCCCCAGGG + Intronic
1065251396 10:23818671-23818693 ACAGGCGACCAGAATCAGCAGGG + Intronic
1067171716 10:43912375-43912397 TCAGAGGCCCATTATTACCATGG + Intergenic
1067427717 10:46222136-46222158 CCAGGGACCCAGCCTCACCATGG - Intergenic
1067583134 10:47458025-47458047 CCAGGGACCCAGCCTCACCATGG - Intergenic
1069051786 10:63802974-63802996 TCAAGGGCACAGAAACCCCAGGG - Intergenic
1070480904 10:76881904-76881926 TCAGAGGCACAGAGTCACCCTGG - Intronic
1072250906 10:93581691-93581713 TCAGTGGGCAAGAATCACCCGGG + Intronic
1073302975 10:102482147-102482169 TCAGGGGCCCGGAATCGGGAAGG + Exonic
1074040396 10:109782746-109782768 TCAGTGGCACAGAGTTACCAAGG + Intergenic
1074814099 10:117131878-117131900 TCATGGGCCCAGAATAGGCAAGG - Intronic
1074825897 10:117215798-117215820 TTAGGTGCACAGAAACACCAAGG + Intergenic
1074918486 10:117982732-117982754 CCAGGAGCTCAGAATCACAAGGG - Intergenic
1075123425 10:119680987-119681009 TAAGGGCACCGGAATCACCAAGG - Intergenic
1075176236 10:120163810-120163832 CCAGGGGCGCAGAAGCTCCATGG + Intergenic
1075522965 10:123154888-123154910 ACAGGCGCCCAGAGTCCCCAGGG - Intronic
1075735743 10:124663715-124663737 TTAAAGGCCCAAAATCACCATGG - Intronic
1076590140 10:131577149-131577171 TCTGGGGCCCAGCCTCTCCAAGG - Intergenic
1077167438 11:1150225-1150247 CCAGGGGCCCAGACCAACCAGGG - Intergenic
1081651552 11:44827367-44827389 TCAGGGTCCAAGACTCAGCAGGG - Intronic
1081709099 11:45205578-45205600 TCAGGGGCACAGCCACACCATGG + Intronic
1082084114 11:48035095-48035117 CCAGGTGCCGTGAATCACCAGGG - Intronic
1082954683 11:58857399-58857421 TCCAGGTCCCAGAATCACCCAGG - Intronic
1083205597 11:61146942-61146964 GGAGGGGCCTAGAATCACCAGGG - Intronic
1088686797 11:112290400-112290422 TCACGGGTACAGAATAACCAGGG - Intergenic
1088982336 11:114875034-114875056 TCTGGGGCCCAGAGGCTCCATGG - Intergenic
1089009277 11:115119497-115119519 TCAGGACCCCAGAATGACCTAGG - Intergenic
1089556758 11:119319445-119319467 TGAGGGGCCCAGGTCCACCATGG - Intronic
1089837892 11:121387515-121387537 TCAGGGGCCATGTATGACCATGG - Intergenic
1090358947 11:126159761-126159783 CCAGGGGCCCAGGCTCAGCACGG - Intergenic
1090444172 11:126749058-126749080 GCAGAGGCCCAGACTCTCCAGGG - Intronic
1091788656 12:3258370-3258392 TCTGGGGCCCAGAATCACCTTGG + Intronic
1092006891 12:5077623-5077645 TGGGGGGGTCAGAATCACCATGG - Intergenic
1094838462 12:34333168-34333190 TGAGAGGCCCAGAGTCACCTGGG - Intergenic
1102226289 12:111230485-111230507 TCATGTGCCCATAATCACCAGGG - Intronic
1102527398 12:113521600-113521622 CCAGGGCTTCAGAATCACCAGGG - Intergenic
1102930978 12:116861990-116862012 TGAGGGGCTCAGAACCAACAGGG + Intronic
1103204303 12:119116376-119116398 TCAGGGGCTCAGTCTTACCAGGG + Intronic
1103592993 12:122005520-122005542 TGAGGAGACCAAAATCACCATGG + Intergenic
1104050706 12:125191727-125191749 TCAGGGGCACAGAATCTGAAAGG - Intronic
1105456369 13:20544809-20544831 TCAGGGAACAAGAGTCACCAAGG - Intergenic
1110237366 13:73230714-73230736 TCAGAAGCTCAGAATAACCATGG - Intergenic
1111913262 13:94335145-94335167 CCAGAGGGCCAGAACCACCATGG - Intronic
1112186940 13:97136790-97136812 TCAGGCCCCTAGAATCCCCATGG + Intergenic
1113146683 13:107215684-107215706 ACACGGGACCAGGATCACCATGG + Intronic
1113927134 13:113947824-113947846 TCAGGGGTCCACACCCACCATGG + Intergenic
1117920369 14:60721997-60722019 ACAGGGGCCCAGAAGCGGCAAGG + Intronic
1122454798 14:101841923-101841945 TCAGGTGCCAAGAAGCTCCATGG - Intronic
1123175831 14:106417824-106417846 GCAGGTGCTCAGAACCACCAAGG - Intergenic
1123721394 15:23064658-23064680 TCAGTGGACCAGAAACACCTTGG + Intergenic
1128134769 15:65254641-65254663 CCAGGGCCTAAGAATCACCATGG + Intronic
1135599434 16:23769450-23769472 TCAGAGGAGCAGAACCACCATGG + Intergenic
1135724560 16:24844702-24844724 TCATCGGCCCAGGATCACCCGGG - Intergenic
1137365410 16:47855594-47855616 TCTGGGACCCAGAATCAGCTGGG + Intergenic
1138314311 16:56055486-56055508 ACCGGGGCTCAGAAACACCAAGG - Intergenic
1138845643 16:60562597-60562619 TCAGGCTCCCAGAATCAACAAGG - Intergenic
1141219041 16:82051980-82052002 TCAAGGGCTCACCATCACCAAGG + Intronic
1141369300 16:83472444-83472466 TCAGGGCTCCAGAGTCATCATGG - Intronic
1143644833 17:8223467-8223489 TCTGGGGCCCAGAAGACCCACGG + Intergenic
1144764349 17:17724709-17724731 TCAGGGGCGCCGAGTCCCCAGGG - Intronic
1145003503 17:19321780-19321802 ACAGGGGGCCAGAATCAGCCTGG + Intronic
1145010784 17:19366488-19366510 TGAGGAGCCCAGAATCACAGGGG - Intronic
1145294277 17:21575538-21575560 CCAGGGTCCCAGTATCTCCAGGG - Intergenic
1145369550 17:22297648-22297670 CCAGGGTCCCAGTATCTCCAGGG + Intergenic
1146579629 17:34025174-34025196 TCAGGGGCTCAGAAGGAACAAGG - Intronic
1147182605 17:38696056-38696078 TCACAGGCCCAGAATCTACAGGG + Intergenic
1147581982 17:41632137-41632159 TCAGGAGCACTGACTCACCAGGG + Intergenic
1150164997 17:62932999-62933021 TGAGAGGCCCAGAAGCACCAAGG + Intergenic
1151344625 17:73494082-73494104 CCAGGGGCCCAGCCTGACCAGGG + Intronic
1151398143 17:73838664-73838686 TCCAGGGCCCAGATTCACCTGGG - Intergenic
1152880763 17:82813478-82813500 TCAGAGGCCCAGCACCACCACGG - Intronic
1153051998 18:908455-908477 CCAGGGGCGCAGACTCACCCTGG - Intronic
1153649719 18:7229340-7229362 TCAGGGTCCCAGGAGCAGCAGGG + Intergenic
1153729560 18:7995991-7996013 TCAGAAGCCCAGAAAAACCAAGG - Intronic
1154025943 18:10707050-10707072 TCAGGTGTTCAGAATCCCCAGGG + Intronic
1156470068 18:37371829-37371851 TCAGGGGCCCAGGAAGAACAAGG + Intronic
1158091786 18:53723327-53723349 TCAGGGGGCCAGGATCAAAAGGG - Intergenic
1163356604 19:16816210-16816232 ACTGTAGCCCAGAATCACCATGG + Exonic
1164151602 19:22557990-22558012 TCAGGGGCACAGCAGCACCCAGG - Intergenic
1164616769 19:29671819-29671841 TCAGTGACCCAGAAACACTATGG + Intronic
1166283638 19:41810621-41810643 TCAGGGGCCCACATTAACAAGGG + Intronic
1166410698 19:42554075-42554097 TCAGGGGCCCACATTAACAAGGG - Intronic
925005213 2:438077-438099 TCATGAGCCAAGAATCACCGAGG + Intergenic
925079769 2:1054601-1054623 AGGGGGTCCCAGAATCACCAAGG - Intronic
925901586 2:8512992-8513014 TCAGGGGCACAGCAGCAGCAGGG - Intergenic
926775371 2:16416958-16416980 TCTGGATCCCAGAATTACCAAGG + Intergenic
927683141 2:25153473-25153495 ACAGAGGCTCAGAATCACCAGGG - Intronic
928284110 2:29974080-29974102 GCAGGAGCACAGAATCAGCATGG + Intergenic
929895908 2:45960682-45960704 GCAGGGGCCCCCAATCCCCAGGG - Intronic
930603963 2:53473248-53473270 TCAGCAGCCCAGAATCTCCAGGG - Intergenic
930869345 2:56154216-56154238 TCAGGGACCCATACTAACCAAGG + Intergenic
932225400 2:70035627-70035649 TGAGGAGTCCAGAATCAACAGGG - Intergenic
932432333 2:71683402-71683424 TCAGGGAACCCGGATCACCAGGG + Intronic
932459897 2:71875442-71875464 CCAGGGACACAGAATCTCCAGGG - Intergenic
932834562 2:75023996-75024018 TCAGGGACCCAGAATTGACAAGG - Intergenic
933919100 2:87026753-87026775 TCTGAGGTCCAGACTCACCATGG + Intergenic
934003894 2:87743154-87743176 TCTGAGGTCCAGACTCACCATGG - Intergenic
934525594 2:95049702-95049724 CCAGGTGCCCGGACTCACCACGG - Exonic
936156072 2:110048206-110048228 TCTGGTGCCCAGAGCCACCAGGG - Intergenic
936188616 2:110323222-110323244 TCTGGTGCCCAGAGCCACCAGGG + Intergenic
937072244 2:119073250-119073272 TCAGGGGCCCAGCTTCAAGAAGG + Intergenic
941850086 2:170171590-170171612 TCAGGATATCAGAATCACCAAGG - Intergenic
943795653 2:191989755-191989777 TCAAGGGCCAAGAACCAACAAGG - Intronic
943868981 2:192968116-192968138 TCAATGGCTCAAAATCACCAGGG - Intergenic
945802217 2:214447973-214447995 CCAGAAGCCCAGAACCACCAGGG + Intronic
1170571507 20:17635382-17635404 TCAGGGGCCCAGAACCCAGACGG + Intronic
1171048108 20:21830007-21830029 GCTGGGGGACAGAATCACCAGGG + Intergenic
1171395283 20:24829183-24829205 TCTGGGGCCCTGCATCACCTGGG - Intergenic
1172756446 20:37288457-37288479 TCAGGAGCCAAGAATCGTCAGGG + Intergenic
1173692410 20:44972945-44972967 TTAGCCACCCAGAATCACCAAGG + Intronic
1173871986 20:46348057-46348079 TCAGGGCTGCAGCATCACCATGG - Intronic
1175748257 20:61476836-61476858 TCAGTGGCCCAGACAGACCATGG - Intronic
1175763038 20:61574004-61574026 TGAGGGCCCCAGAAGCCCCACGG + Intronic
1175861557 20:62152939-62152961 TCAGGAGTCAAGAAGCACCATGG + Intronic
1176388790 21:6152842-6152864 TCAGGGACACACAAACACCAGGG + Intergenic
1177722973 21:24931072-24931094 TTGGGTGCCCAGAATCACTAAGG + Intergenic
1177755581 21:25343183-25343205 TCAAGGCTCCATAATCACCAGGG + Intergenic
1178132416 21:29588876-29588898 TATGGGGCCCAGAATGACAAAGG - Exonic
1178373342 21:32046287-32046309 ACAGAGGCCCAGAACTACCAGGG + Intergenic
1179547500 21:42122491-42122513 TCAGGGATCCAGGCTCACCATGG - Intronic
1179734682 21:43385406-43385428 TCAGGGACACACAAACACCAGGG - Intergenic
1181694936 22:24588349-24588371 GGAGGGGCTCAGATTCACCATGG - Intronic
1182688883 22:32142148-32142170 GCAGGGCCCCTGAAGCACCATGG + Intergenic
1182739503 22:32557285-32557307 TGAGGGGCCCTGATTCACAAGGG + Intronic
1183112672 22:35662343-35662365 TTGGGGCCCCAGAATCACTAAGG + Exonic
1183831034 22:40418484-40418506 TCAGGGCCCCAGCCTCATCAAGG - Exonic
1184369602 22:44074242-44074264 TCAGGGGCTCAGAAATGCCAGGG - Intronic
1184803170 22:46774740-46774762 TCGGGGGCCCAGAAATATCAGGG - Intronic
1185271635 22:49932150-49932172 GCAGGGGGCCAGAATCATCATGG + Intergenic
951641869 3:24845387-24845409 TCAGGGACCCAGGATAACAAAGG + Intergenic
952919165 3:38273178-38273200 TAAGGGGCCCACAAACCCCATGG + Intronic
954090506 3:48280055-48280077 TCAAGGGCCCTGATTCCCCAGGG + Intronic
954163745 3:48739922-48739944 TCAGGGACCCAGTGCCACCAAGG + Intronic
954801671 3:53190597-53190619 TCACAGGCCCAGAATCTACAGGG + Intronic
955479459 3:59374700-59374722 TCTGTTGCCCAGCATCACCAAGG + Intergenic
956404745 3:68916688-68916710 TCAGCACCACAGAATCACCAGGG + Intronic
959237628 3:103745266-103745288 TGAGTGGCCCAGAATCTTCAGGG - Intergenic
959498043 3:107073924-107073946 TCAAGAGCCCAGAAGCACCTGGG + Intergenic
960261548 3:115574050-115574072 GCAGAGGCCCAGAATGACAAAGG + Intergenic
960687729 3:120311195-120311217 TTAGGCCCCCAGAATCACTAAGG - Intergenic
961564387 3:127753339-127753361 TCAAGGACCCAGCATCAGCAGGG - Intronic
963081890 3:141402386-141402408 TCACGGGTCCGGAAGCACCATGG + Intronic
965063764 3:163816726-163816748 TCAGGAGCTCAGAATCAGCTTGG + Intergenic
966619868 3:181952333-181952355 TCTGGTGCCCAGGAGCACCATGG + Intergenic
967105476 3:186251846-186251868 CCAGCGGTCCAGCATCACCAAGG + Exonic
969193512 4:5542891-5542913 TCAGTGGCCCTGGAACACCAAGG - Intronic
971083541 4:23243913-23243935 TCTGGGGCCAAGAAGCCCCAAGG + Intergenic
978644372 4:110911692-110911714 TCAGGGGCCAAGTTTCATCAAGG - Intergenic
986301946 5:6484331-6484353 GGAGGGGCCCAGAATCCTCAGGG - Intronic
987306587 5:16643220-16643242 TCAGGGGCCCAGATTGACAGGGG - Intergenic
987391649 5:17381744-17381766 TCAGGGTCCTAGAAACAACAGGG - Intergenic
995269182 5:110201844-110201866 TCAGGGTCCATGATTCACCATGG + Intergenic
998087590 5:139339446-139339468 TCAGGGGCCCAGTATTTCCTTGG - Intergenic
998444200 5:142186014-142186036 TCAGTGGCTCAGAAACACCCAGG - Intergenic
999200376 5:149812070-149812092 TGAAGGGCTGAGAATCACCAAGG + Intronic
999206460 5:149851800-149851822 TCCTTGGCCCAGAACCACCATGG + Exonic
1003197577 6:3928759-3928781 CCAGAGGCCCAAACTCACCAAGG - Intergenic
1004806027 6:19204954-19204976 CCAGTGGCCCAGAAGCACCTTGG - Intergenic
1005262841 6:24080170-24080192 TCAGTGGCTTAAAATCACCAGGG - Intergenic
1007506339 6:42338035-42338057 TCACGTGCCCACAATCACCTGGG - Intronic
1013663984 6:112327862-112327884 TCAGGGACCCAGCCTCACAATGG + Intergenic
1014469163 6:121793922-121793944 ACAGGGCCCCAGCATGACCAAGG + Intergenic
1015108535 6:129566054-129566076 TCACAGACCCAGAAACACCAGGG + Intergenic
1017511007 6:155114434-155114456 TCAAGGCCACAGAATAACCAAGG - Intronic
1018127681 6:160697315-160697337 TCTGAGGTCCAGACTCACCATGG - Intergenic
1018848605 6:167572196-167572218 TCAGGGGCACACAAGCAGCAGGG - Intergenic
1019061212 6:169259503-169259525 AGAGGGGCCCAGAATTCCCAGGG + Intergenic
1019567955 7:1694032-1694054 TCAGGGCCACAGACTCAGCAGGG + Exonic
1021691659 7:23236119-23236141 TCATGGGCTCTGACTCACCAGGG - Intronic
1023082050 7:36534802-36534824 ACAGTGGCCAGGAATCACCAGGG + Intronic
1025615230 7:63112546-63112568 CCAGGGGCACAGAAACATCATGG - Intergenic
1026365031 7:69639695-69639717 TCAGAGGCACAGAATGACCTGGG - Intronic
1026878818 7:73895114-73895136 TCAGGGGGCCTGAATCATCGGGG - Intergenic
1028480256 7:91296994-91297016 TCAGGGGTCCCCAAACACCAGGG + Intergenic
1029212702 7:98921887-98921909 TCAGGGCCCCAGCATCACTGTGG + Exonic
1033149280 7:138899261-138899283 TCAGGGGCCCAGAATCACCATGG + Intronic
1037309102 8:17536157-17536179 TCAGGGCCCCAGGAATACCAAGG - Intronic
1039458062 8:37721025-37721047 CCCGAGGCCCAGAGTCACCAGGG - Intergenic
1041425778 8:57718759-57718781 TCAGTGGCTCAGAATGGCCAAGG + Intergenic
1042454462 8:68984543-68984565 TCAGGAGCCCAGAAACCTCAAGG - Intergenic
1043913788 8:85896502-85896524 TCAGGGGACCAGATTAACCCAGG + Intergenic
1047712281 8:127564499-127564521 TCAGGGGGCTGGAATCACCCAGG + Intergenic
1047927178 8:129693242-129693264 TCAGGGGCACAGGATCCACAAGG + Intergenic
1048854904 8:138678331-138678353 TCAGAGGCCCAGAGGGACCAGGG - Intronic
1049433454 8:142575718-142575740 GCAGGGGCCCGGGATCAGCAGGG + Intergenic
1049450636 8:142659618-142659640 TCAGAGGCTCAGGACCACCACGG + Intronic
1049649719 8:143760054-143760076 TCTGGGGCCCCAAAACACCATGG - Intergenic
1053174216 9:35910551-35910573 TCAAGGGCCCAGGATCCTCAGGG + Intergenic
1056103755 9:83326560-83326582 CCTGAGGCCCAGACTCACCAAGG + Intronic
1056397886 9:86198023-86198045 TCAGGGGCACAGGAACACAAGGG + Intergenic
1057178698 9:93017679-93017701 TCAGGGGCTCAGACTCTGCAGGG + Intronic
1057405817 9:94769799-94769821 TCAGGTGCCCAGATGCACAATGG + Intronic
1060377440 9:123129418-123129440 ACAAGGGCACAAAATCACCATGG + Intronic
1061746722 9:132745622-132745644 TCAGGGCCCCAGTGTCACCACGG - Intronic
1061946338 9:133910295-133910317 TCAGGAGCCGAAACTCACCAGGG - Intronic
1185667107 X:1774565-1774587 TCAGGGGTCCTGAATCCCCAGGG - Intergenic
1185737031 X:2502015-2502037 GCAGGGGACCAGGACCACCACGG + Intronic
1187187009 X:16996363-16996385 TCAGGTCCCCTGCATCACCATGG - Intronic
1189328570 X:40128883-40128905 ACACAGGCCTAGAATCACCATGG + Intronic
1190127989 X:47723015-47723037 TCAAGGACCCAGCCTCACCACGG + Intergenic
1192249910 X:69403397-69403419 TCTGTGGCCCAAAATAACCAAGG - Intergenic
1192395265 X:70774162-70774184 CCTGGGGCCCAGCAGCACCAGGG + Intronic
1192735419 X:73845601-73845623 GCAGGGGTACTGAATCACCAAGG - Intergenic
1195526560 X:105897599-105897621 TTAGGGGCCAAGAATTACCTAGG - Intronic
1197064338 X:122220773-122220795 TCAGGGGCCCAGGACCAGCATGG + Intergenic
1199118082 X:144016138-144016160 GCAGGGCCTCAGAATCCCCAGGG - Intergenic
1200162898 X:154018450-154018472 CCCGAGGCCCAGAACCACCAAGG + Intronic
1200767238 Y:7090448-7090470 TCAGAGGTGCAGAATCACCTTGG - Intronic