ID: 1033150816

View in Genome Browser
Species Human (GRCh38)
Location 7:138913744-138913766
Sequence GCTGCTGGTGTGACTCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 203}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033150816_1033150822 10 Left 1033150816 7:138913744-138913766 CCTTGCTGAGTCACACCAGCAGC 0: 1
1: 0
2: 0
3: 19
4: 203
Right 1033150822 7:138913777-138913799 TGGCCCACATAGGCTCCAAGTGG 0: 1
1: 0
2: 0
3: 6
4: 109
1033150816_1033150826 15 Left 1033150816 7:138913744-138913766 CCTTGCTGAGTCACACCAGCAGC 0: 1
1: 0
2: 0
3: 19
4: 203
Right 1033150826 7:138913782-138913804 CACATAGGCTCCAAGTGGGTTGG 0: 1
1: 0
2: 1
3: 14
4: 96
1033150816_1033150823 11 Left 1033150816 7:138913744-138913766 CCTTGCTGAGTCACACCAGCAGC 0: 1
1: 0
2: 0
3: 19
4: 203
Right 1033150823 7:138913778-138913800 GGCCCACATAGGCTCCAAGTGGG 0: 1
1: 0
2: 0
3: 11
4: 66
1033150816_1033150820 0 Left 1033150816 7:138913744-138913766 CCTTGCTGAGTCACACCAGCAGC 0: 1
1: 0
2: 0
3: 19
4: 203
Right 1033150820 7:138913767-138913789 CAACTCCGCATGGCCCACATAGG 0: 1
1: 0
2: 1
3: 11
4: 92
1033150816_1033150817 -10 Left 1033150816 7:138913744-138913766 CCTTGCTGAGTCACACCAGCAGC 0: 1
1: 0
2: 0
3: 19
4: 203
Right 1033150817 7:138913757-138913779 CACCAGCAGCCAACTCCGCATGG 0: 1
1: 0
2: 1
3: 9
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033150816 Original CRISPR GCTGCTGGTGTGACTCAGCA AGG (reversed) Intronic
900313076 1:2043751-2043773 CCTTCTGGTGAGACTCAGCCAGG + Intergenic
904454736 1:30640763-30640785 GCTGTTGGTGTCTCTGAGCAGGG + Intergenic
905748262 1:40437855-40437877 GCTACTGGTTTCACTCAGAATGG - Intergenic
908466517 1:64401588-64401610 GCTGCTGATGTGAAGAAGCAGGG - Intergenic
911785502 1:101941319-101941341 GCTCAGGGTGTGGCTCAGCAGGG + Intronic
912457602 1:109808332-109808354 GATGGTGCTTTGACTCAGCAGGG + Intergenic
916058819 1:161085368-161085390 GCTGTTGTGGTGACTCAGCCAGG - Intronic
917173909 1:172209660-172209682 GCTGCAGTTGTGGATCAGCATGG - Intronic
922911506 1:229221556-229221578 CCTGCTGCTGTGACCCTGCATGG - Intergenic
1063161344 10:3421007-3421029 GGTGCGGGTGGGACACAGCAGGG + Intergenic
1067424982 10:46201828-46201850 GCAGCTAGCGTGACTTAGCAAGG - Intergenic
1070861418 10:79667660-79667682 GCAGCTAGCGTGACTTAGCAAGG - Intergenic
1070875828 10:79807933-79807955 GCAGCTAGCGTGACTTAGCAAGG + Intergenic
1070935227 10:80288891-80288913 GCTGGTGGTGGGCCACAGCACGG + Intronic
1071896635 10:90075443-90075465 GCTGCAGGTCTGACCCAGCATGG - Intergenic
1072761790 10:98062728-98062750 GCTGCTGGAGGAAGTCAGCATGG + Intergenic
1076723681 10:132403821-132403843 GCAGCTCGTGTGGCCCAGCAGGG + Intronic
1078350741 11:10591196-10591218 GCTCCTGGTATGGCACAGCAGGG - Intronic
1078547047 11:12254106-12254128 GATGCTGCTGTCACTCAGAAAGG + Intronic
1080208391 11:29756710-29756732 TCTGCTGCTGCGACTCAGCTAGG - Intergenic
1083453570 11:62762907-62762929 GGTGCTGGTGTGATCCAGCCAGG + Exonic
1083903302 11:65654381-65654403 GGAGCTGATCTGACTCAGCAGGG + Exonic
1084444157 11:69193800-69193822 CCTGTTGGTGTGAGTCAGCAGGG + Intergenic
1084514499 11:69629145-69629167 GCTACTGCTGTGGCTCAGCCTGG + Intergenic
1084620817 11:70269400-70269422 GCTGTTGGTGTGAGGCAGCCAGG - Intergenic
1087871148 11:103294654-103294676 GCTTCAGGTATGACTCAGCATGG - Intronic
1090625037 11:128599855-128599877 GCTGCTGGTGGTTCTCAGAAGGG - Intergenic
1091511529 12:1131942-1131964 TCTGCTGGTGTGAATAAACAAGG + Intronic
1091769555 12:3142167-3142189 GCTGCTGGGGTGACGCTGCTGGG + Intronic
1091800487 12:3321652-3321674 GCTGCTGGTGAGAGGCAGCAGGG + Intergenic
1092548160 12:9469515-9469537 GCTGCTTAGGTGACTCAGCCTGG + Intergenic
1093104133 12:15065733-15065755 GTTGCTGCTGAGGCTCAGCAGGG + Intergenic
1094504842 12:31052938-31052960 GCTGCTTAGGTGACTCAGCCTGG - Intergenic
1096489098 12:52004007-52004029 GCTGCAGGTGAAATTCAGCAGGG - Intergenic
1099200720 12:79673495-79673517 GCTGCTCTAGTGACTAAGCAAGG - Intronic
1101672244 12:106886382-106886404 GCTGCTGGAGAGATTCAGAAGGG - Exonic
1101793931 12:107955730-107955752 GCTGATGGTGAGACTCCTCAGGG + Intergenic
1102848834 12:116218843-116218865 GCTGCTGGGGTGGCTCAGGCTGG - Intronic
1103465444 12:121138783-121138805 GCTCCTGGTGGGACTCAGGAAGG - Intronic
1104089992 12:125508398-125508420 GCTGCTCCTGTACCTCAGCAGGG + Intronic
1104308905 12:127636017-127636039 GCTGATGAGATGACTCAGCAGGG - Intergenic
1105689894 13:22826946-22826968 GGTGCTGGTGTGGCCGAGCACGG + Intergenic
1105938247 13:25121464-25121486 GCTTCAAGTGTGATTCAGCATGG + Intergenic
1106922880 13:34582918-34582940 CCTACTGGAGTGACTCAACAGGG + Intergenic
1108031828 13:46239666-46239688 GCTGCTGTTGTGTCTCTGCCAGG - Intronic
1108884711 13:55165567-55165589 GCAGCTGTTGTGGCGCAGCAGGG - Intergenic
1111128770 13:83947154-83947176 AGTCCTGGTGTAACTCAGCATGG + Intergenic
1113867198 13:113534676-113534698 GCTGCTGGAGAGACTGAGCTGGG + Intronic
1114821016 14:26019405-26019427 ACTCCTGGTGTGCCTCAGCCTGG + Intergenic
1117865970 14:60149493-60149515 GCGGCTGATGTTAATCAGCATGG - Exonic
1118753829 14:68824165-68824187 GGTGCGGATGTGACTCAGCAAGG + Intergenic
1119697041 14:76721280-76721302 GTAGCTGGTGTGACCCAGGATGG - Intergenic
1119949186 14:78727172-78727194 ACTGCTGGATTAACTCAGCAAGG - Intronic
1121713095 14:96053608-96053630 GCTGCTGTTGGGGCTCAGCCTGG - Intronic
1122597680 14:102904384-102904406 GATGCTGGTATGACTGGGCATGG + Intronic
1124707351 15:31977012-31977034 TCTGGTGTTGTGACCCAGCATGG + Intergenic
1127869640 15:63060659-63060681 GCTTCTGCTTTGACTCAGAATGG - Intronic
1128695113 15:69755911-69755933 GCTCTTGGTGAGACTCAGCCAGG + Intergenic
1128904130 15:71452240-71452262 GTTGCTGGGGTCACTCTGCAAGG + Intronic
1129172361 15:73816087-73816109 GTTGCTGGTGGGACAAAGCATGG + Intergenic
1130419867 15:83734589-83734611 CCGGCAGGTGTGAGTCAGCAGGG - Intronic
1130882378 15:88066453-88066475 GCTGTGGGTGTGATTCAGAAAGG - Intronic
1131620137 15:94059580-94059602 GATGCTGGGGTGTCTCAGAAAGG - Intergenic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1133297191 16:4760339-4760361 CCTGCAGGTGGGACTCTGCAGGG + Intronic
1133324385 16:4934604-4934626 ATTGCTGGTGAGATTCAGCATGG - Intronic
1135654517 16:24236030-24236052 GCTGCTGGGGTGGGTGAGCATGG - Intergenic
1138903639 16:61303947-61303969 GTGGCTGGTGTGAATGAGCAGGG - Intergenic
1141059144 16:80848963-80848985 TCTGCTTGTGTGACTTAGCTTGG - Intergenic
1143355193 17:6322600-6322622 TCAGCTGCTGTGTCTCAGCATGG + Intergenic
1145241633 17:21243727-21243749 GCTGCTGCTGGGACTTAGCTGGG - Intronic
1145408139 17:22627932-22627954 GCAGCTAATGTGACTTAGCAAGG + Intergenic
1146609178 17:34289486-34289508 CCTGCTGGTATAACTCTGCATGG + Intergenic
1147059017 17:37859091-37859113 GCTGCTTGTGAGGCTGAGCAGGG + Intergenic
1148674653 17:49438425-49438447 GCTGCTGGAGGGACGCTGCAGGG + Intronic
1148776457 17:50098365-50098387 GCAGCTGCTGTGACTTCGCATGG - Intronic
1149542208 17:57476178-57476200 GCTGCTGATGTAAATCAGCTTGG - Intronic
1149894027 17:60415125-60415147 GCTGCAAGTGAGACTAAGCAAGG - Intronic
1150221216 17:63496903-63496925 GCTGCTGGACTGGCTCCGCACGG + Exonic
1150335249 17:64326243-64326265 GCTGCAGGTGGAACTCAGCAAGG + Intronic
1152500562 17:80705893-80705915 CCTGCTGATGTGACTGAGAAAGG - Intronic
1153656393 18:7286580-7286602 GCTGATGGTGTGATTCAGTCAGG + Intergenic
1153980164 18:10302112-10302134 GCTGCTGGTTTTACTCATCTCGG + Intergenic
1154334158 18:13452587-13452609 GCTGCTGCTATGAGTCAGCCTGG + Intronic
1156377654 18:36529308-36529330 GCTGCTCGTGTTATACAGCAAGG + Intronic
1157265035 18:46211318-46211340 GCTACTGGGGAGGCTCAGCAAGG - Intronic
1158289590 18:55924280-55924302 ATTGCTGATGTGACTCTGCATGG + Intergenic
1160106854 18:75986572-75986594 GCTGCAGATGGGCCTCAGCATGG - Intergenic
1160329588 18:77979249-77979271 GCTGCAGGTGTTCCTTAGCAGGG - Intergenic
1160894751 19:1397182-1397204 GCTGCTGGTGACACACAGCTGGG + Intronic
1162617491 19:11814161-11814183 GCTTCTGCTGTCACTCAGCACGG + Intergenic
1164553695 19:29233637-29233659 GCAGCTGGGGGGCCTCAGCAAGG - Intergenic
1166276391 19:41757181-41757203 TCTGATGGGGGGACTCAGCAGGG + Intronic
1166281646 19:41798170-41798192 TCTGATGGGGGGACTCAGCAGGG + Intronic
925414815 2:3661979-3662001 TCAGCTGGTGGGACTGAGCAGGG + Intronic
925455852 2:4016054-4016076 GTTGCTGGTGTGACTCAGTCTGG + Intergenic
927179066 2:20431154-20431176 TCTACAGGTGTGACTCTGCAGGG + Intergenic
933105435 2:78318794-78318816 GCTGCTGGTTGGATTCTGCAAGG + Intergenic
935360560 2:102243265-102243287 GCTGCTGGTGATTCTCAGTAGGG + Intergenic
936281449 2:111143690-111143712 GCTTCTGTCGTGACTCAGCTGGG + Intronic
937103387 2:119288879-119288901 GGGGCTGGAGTGACTCACCAAGG - Intergenic
937648251 2:124290139-124290161 ATCGCTGGTCTGACTCAGCATGG + Intronic
938829512 2:135036515-135036537 GATGCTGGTGTCCCTCAGGAGGG + Intronic
938928171 2:136063281-136063303 GTTACAGGTGTGACCCAGCATGG + Intergenic
941050657 2:160729582-160729604 TCTGCTTGTCTGACTTAGCAAGG + Intergenic
941927020 2:170906045-170906067 TCTGCTGGTCTCACCCAGCAGGG + Intergenic
942068419 2:172293699-172293721 GCTTCTGGGGTGACTTATCATGG + Intergenic
942447263 2:176086204-176086226 GCTGCTCCTGTGACCCAGGAAGG + Intergenic
943733499 2:191328467-191328489 ACTGCCAGTGTGACACAGCAGGG - Intronic
944115261 2:196179020-196179042 GCTGCTTCTGTGACTGAGGATGG + Intergenic
946337668 2:219049413-219049435 GCAGCAGGTGTGACTCAGGCCGG + Intergenic
946629939 2:221656163-221656185 GCTCCTGGTTTGACTTACCATGG - Intergenic
947817793 2:233049506-233049528 GCTGTTGGAATCACTCAGCAGGG + Intergenic
947946684 2:234109548-234109570 CCTGTTGGTGTGAGTCAGCGGGG + Intergenic
1169183888 20:3595432-3595454 ATTGCTGGTGCTACTCAGCAGGG + Intronic
1169234800 20:3922418-3922440 GCTGCTTCTGTGTCTCAGGAGGG + Intronic
1172846208 20:37931217-37931239 GATGCTGGAGTAACTCAGGAGGG + Intronic
1174126971 20:48313602-48313624 GCTGCTTGTGTGTCTCAGGGAGG - Intergenic
1175685427 20:61024705-61024727 ACTACTGGAGTGACTCAGGAAGG - Intergenic
1175718496 20:61271444-61271466 TCTGCTGTGCTGACTCAGCAGGG - Intronic
1177823257 21:26055157-26055179 GCTGCAGGTGTCACTTTGCAGGG + Intronic
1179939018 21:44626508-44626530 GCTGCCATTGTGCCTCAGCAAGG + Intronic
1182099970 22:27650852-27650874 GCGGCTGGTGTCACCCACCAGGG + Intergenic
1184095287 22:42313035-42313057 GGTGATGGTGTGACTCAGGCTGG - Intronic
1184745023 22:46451170-46451192 CCTGTAGGTGTGACTCAGGAGGG - Intronic
1185059619 22:48599495-48599517 GCCGCTGATCAGACTCAGCATGG + Intronic
1185151540 22:49166838-49166860 GCTGCTGGTGACCCTCAGGATGG + Intergenic
949903742 3:8840966-8840988 GCTGCTTGTGGGAGTAAGCAGGG + Intronic
957663958 3:83199115-83199137 ACTGCTGGAGTGTCTCTGCAAGG + Intergenic
960372460 3:116857737-116857759 TCTGCTGGTCTCACTCATCAAGG + Intronic
960794420 3:121470473-121470495 GTTGCTGCTGTTACCCAGCACGG - Intronic
961306038 3:125959524-125959546 GCGGCTGGCCTGGCTCAGCAGGG - Intergenic
962381872 3:134904574-134904596 GCGGATGGTTTGACTCTGCATGG + Intronic
964739611 3:159951611-159951633 GCTGCTGGACAGACTCAGGATGG - Intergenic
966572060 3:181454781-181454803 TATGCTGGTGAAACTCAGCAAGG + Intergenic
967869753 3:194220306-194220328 GCTGCTGGTGTGGCCCAGCCCGG + Intergenic
968096318 3:195933132-195933154 GCTTCAGGTCTGACCCAGCATGG + Intergenic
968506301 4:972873-972895 GCAGCAGGTGTGGCTAAGCAGGG - Intronic
969402097 4:6962416-6962438 GCTGCAGGTGAGTCTCACCAGGG + Intronic
969804572 4:9596922-9596944 GCTGCTGCTGTAACCCAGCTGGG + Intergenic
971046333 4:22809196-22809218 GCTGCTGTTGTTACTCTGCCTGG + Intergenic
972827791 4:42781104-42781126 GCTGATGGTGTGAAACAGCATGG + Intergenic
973074090 4:45901015-45901037 GCTTCAGGTGTGACCCAGCCTGG + Intergenic
973329900 4:48902487-48902509 CCTGCTGCTGTGACTCACCCTGG - Intronic
974566295 4:63581285-63581307 GCTGCCTGTGTGACTCAGTCTGG + Intergenic
975095222 4:70449882-70449904 GCTTCAGGTCTGACCCAGCATGG - Intronic
977610268 4:99023128-99023150 GCTGCTCGTGTCAGTCAACACGG - Intronic
979099506 4:116598268-116598290 GGTGCTGGTGTGCCGCAGCCAGG - Intergenic
981873164 4:149510225-149510247 GCTACTGGTAAGACTGAGCATGG + Intergenic
982901103 4:161003630-161003652 GCTGCTGTTGCGACCCAGCTGGG - Intergenic
985570164 5:640526-640548 GCTGCTGCTGCTGCTCAGCAAGG - Exonic
985614288 5:910309-910331 GCTGCTGGCGTCTCTCCGCAGGG + Intronic
986301305 5:6480327-6480349 CCTGCTGGAGTGTCTCAGTATGG + Intronic
987092452 5:14520579-14520601 GGTGCAGGTGTGACTGGGCATGG + Intronic
988460776 5:31435567-31435589 GCTGCTGGTGAAACTCACAAAGG + Intronic
989468260 5:41783406-41783428 GTTGCTGATATGACTTAGCAGGG - Intronic
993358783 5:86947253-86947275 TCTGCTTCTGTGACTCTGCAGGG + Intergenic
993708224 5:91195725-91195747 GCTGCAGGTTTGACTCAGCTGGG - Intergenic
993959708 5:94281807-94281829 GCTGCTGCTGAGACTCAGTAGGG - Intronic
994218869 5:97171488-97171510 GCTGCTGGGGATACACAGCATGG - Intronic
997277998 5:132614337-132614359 GTAGCTGGTGTGACTTACCAAGG - Intronic
997994481 5:138575023-138575045 GCGAGGGGTGTGACTCAGCAGGG + Intronic
1000436301 5:161213974-161213996 GCTGCTGGTCTGACACACTACGG - Intergenic
1002290381 5:178196399-178196421 GCTGCCTCTGAGACTCAGCAGGG + Intergenic
1002429279 5:179193800-179193822 CTTGGTGGTGTGTCTCAGCAGGG - Intronic
1003184692 6:3820760-3820782 GCTGCACGTGGGAATCAGCAAGG - Intergenic
1004869692 6:19892392-19892414 GCTGCTGTGGTGACTCAGCCGGG - Intergenic
1005155918 6:22806264-22806286 GGTGCTGTTCTGGCTCAGCAGGG + Intergenic
1005661092 6:28000495-28000517 GATGCTGGTGAGACCCAGTAAGG + Intergenic
1005941408 6:30562949-30562971 GCTGCTTGTGAAACTCAGCCAGG + Exonic
1006267898 6:32940768-32940790 GCTGCTGCTGGGGCTCAGCCTGG - Exonic
1006825178 6:36929399-36929421 GCAGCTGGGGTGAGCCAGCAAGG - Intergenic
1007547337 6:42704413-42704435 GCTGCTGTAGTAGCTCAGCAGGG + Exonic
1007780071 6:44247570-44247592 CCCGCTCGGGTGACTCAGCACGG + Intronic
1007929188 6:45675553-45675575 GTTCCTGGTGTCTCTCAGCAGGG - Intergenic
1012078175 6:94721655-94721677 GGTGCTGGGGTGAGGCAGCATGG - Intergenic
1016179015 6:141120866-141120888 GGGGGTGCTGTGACTCAGCATGG - Intergenic
1018653400 6:166009906-166009928 GCTGCTGGGATCACTCTGCAGGG + Intergenic
1019597844 7:1866584-1866606 GCTGCTGGTGTGAGACGCCACGG + Intronic
1021520987 7:21538725-21538747 GCTGTTTGTGTGTCTCAGCCAGG - Intergenic
1021904772 7:25322422-25322444 GCTGGTGGTGTGAGCAAGCAAGG - Intergenic
1022521149 7:31007761-31007783 GCTGCTGGTTTTACTCTGGAAGG + Intergenic
1022572094 7:31464850-31464872 TCTGCTTGTGTGACTGAGAAGGG + Intergenic
1023535438 7:41203679-41203701 TGGGCTGGTGTGACCCAGCAGGG - Intergenic
1024336433 7:48211544-48211566 GCTTCAGGTGTGACCCAACATGG - Intronic
1026278366 7:68900195-68900217 GCTGCTGGTTAGAGCCAGCATGG - Intergenic
1026437780 7:70414802-70414824 GCTGCTGGGGTGAATCTCCAGGG + Intronic
1027524172 7:79245838-79245860 GCTTCAGGTGTGGCCCAGCATGG + Intronic
1029284283 7:99455370-99455392 TCTGCAGGTGTGACTCTGTATGG - Intronic
1033150816 7:138913744-138913766 GCTGCTGGTGTGACTCAGCAAGG - Intronic
1033622020 7:143070123-143070145 GCTGATGGTGTGCCCCAGCAGGG + Intergenic
1035663421 8:1363803-1363825 GCTGCGGGTGTGACAGAGCCCGG + Intergenic
1036706039 8:11048110-11048132 GCTGCTGCAGTGACTGAGCGTGG - Intronic
1037571497 8:20161849-20161871 GCTGCTGGGTAGACTCAGCCCGG - Intronic
1039656347 8:39412114-39412136 GCTTCAGGTGTGACACAGCAGGG + Intergenic
1039890783 8:41683916-41683938 TTTGTTGATGTGACTCAGCATGG - Intronic
1040511402 8:48099628-48099650 GCTTCAGGTCTGACCCAGCACGG - Intergenic
1042328567 8:67554705-67554727 GCTGTTGGTGTGAGTCACAAAGG + Intronic
1042331021 8:67580773-67580795 GGGGGTGCTGTGACTCAGCATGG - Intronic
1043485151 8:80691876-80691898 GCAGTTGGTGTGCTTCAGCAAGG - Intronic
1044399178 8:91750554-91750576 GCTGATGATGTGACTCAGGTTGG + Intergenic
1044845090 8:96372535-96372557 AATGCTGGGGTGACACAGCAGGG - Intergenic
1045670732 8:104550551-104550573 GATGCTGGTGTCATTCACCAAGG - Intronic
1048395938 8:134014077-134014099 GCTGCTGTTCAGACTCAGGAGGG + Intergenic
1048425057 8:134315806-134315828 GTTGCTGCTGTAACTCAGGAAGG + Intergenic
1048912589 8:139150321-139150343 GTTTCTGGTGTGAGTCAGGAAGG + Intergenic
1049393504 8:142384071-142384093 GCTGGTGGTGTGACAAAGAAAGG - Intronic
1049641284 8:143717159-143717181 GCTGCTGGTGTCACTTTACAAGG + Intronic
1050248270 9:3714317-3714339 GCTTCAGGTCTGACCCAGCACGG + Intergenic
1052937786 9:34107480-34107502 CCTGGAGGTGTGACCCAGCAGGG - Exonic
1052981256 9:34451370-34451392 GCTAGAGGTGTGGCTCAGCAGGG - Intronic
1060247196 9:121957004-121957026 GATTCTGGTTTGAGTCAGCAAGG - Intronic
1060751856 9:126174734-126174756 GCTGCTGGAGCCACTCAGCCTGG + Intergenic
1061248991 9:129415607-129415629 GGAGCTGGTGTGACCCAGGATGG + Intergenic
1061582075 9:131544393-131544415 GAAGCTGGTGTGACCCAGCCTGG - Intergenic
1062678175 9:137760682-137760704 GCGGCTGTGGTGACTCAGCATGG + Intronic
1190577606 X:51856413-51856435 GCTGCTGGTGGGAATGAGAAAGG + Intronic
1191979496 X:66910455-66910477 GTGGCTGGAGTGACTGAGCAAGG + Intergenic
1192248506 X:69392126-69392148 GCTGCTGGTCTGCCTCAGTGAGG + Intergenic
1194285586 X:92007040-92007062 GCTTCAGGTGTGACCCAGCAGGG - Intronic
1198458257 X:136838469-136838491 GCTGCTGGTGTGAGTCCCAAAGG + Intergenic
1200603154 Y:5231578-5231600 GCTTCAGGTGTGACCCAGCAGGG - Intronic
1201329571 Y:12803318-12803340 CCTGCTGATGTGGCTCAACAGGG + Intronic