ID: 1033152127

View in Genome Browser
Species Human (GRCh38)
Location 7:138924686-138924708
Sequence CAGCCGCTTTGTCCCTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033152127_1033152133 14 Left 1033152127 7:138924686-138924708 CCCCAGGAGGGACAAAGCGGCTG 0: 1
1: 0
2: 1
3: 13
4: 145
Right 1033152133 7:138924723-138924745 ATCACTTCTGCAGTTAACTCAGG No data
1033152127_1033152134 17 Left 1033152127 7:138924686-138924708 CCCCAGGAGGGACAAAGCGGCTG 0: 1
1: 0
2: 1
3: 13
4: 145
Right 1033152134 7:138924726-138924748 ACTTCTGCAGTTAACTCAGGAGG No data
1033152127_1033152131 -10 Left 1033152127 7:138924686-138924708 CCCCAGGAGGGACAAAGCGGCTG 0: 1
1: 0
2: 1
3: 13
4: 145
Right 1033152131 7:138924699-138924721 AAAGCGGCTGCAGTGCCAAAGGG 0: 1
1: 0
2: 0
3: 7
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033152127 Original CRISPR CAGCCGCTTTGTCCCTCCTG GGG (reversed) Intronic
900150936 1:1179155-1179177 ATGCCGCTCTGACCCTCCTGTGG - Intronic
901121309 1:6896331-6896353 CTGCCTCTGTGTCCTTCCTGGGG + Intronic
902037744 1:13469915-13469937 CACCCCCTTGGTCCCTGCTGTGG + Intergenic
902205197 1:14863342-14863364 CAGACACTCTGTCCCTCCGGGGG + Intronic
902719707 1:18295850-18295872 CAGCCCCCTCGTCCCTCCAGGGG + Intronic
903244070 1:22003037-22003059 CAGCCGCGTTGTCCATGGTGAGG + Exonic
903563357 1:24245756-24245778 CTGACCCTTTGTCCCTCCCGGGG + Intergenic
904292624 1:29497685-29497707 CAGAAGCTCTGTCCCTCCAGTGG - Intergenic
905316462 1:37084595-37084617 CAGCCACTTGGTCCAGCCTGAGG - Intergenic
905900582 1:41579842-41579864 AAGCTGCTTTGTCCCTCCTGAGG - Exonic
907286698 1:53385015-53385037 AAGGTGCTGTGTCCCTCCTGGGG - Intergenic
910835256 1:91501651-91501673 CAGCTGCTTTGCTCCCCCTGTGG + Exonic
910976207 1:92908784-92908806 CAGCCCCTTTGTCCCCTCTTTGG - Intronic
911060554 1:93744304-93744326 CAGTCCCTTTCTTCCTCCTGAGG + Intronic
917989542 1:180359206-180359228 CAGTCGCTTTGTGCTTCCTTTGG - Intronic
922175760 1:223195839-223195861 CAGCAGGATTGTTCCTCCTGAGG + Intergenic
1064141597 10:12795362-12795384 CAGACTCTTTCTCCTTCCTGTGG + Intronic
1065592444 10:27279123-27279145 CAGCTGCTTTTTCCTTCTTGGGG - Intergenic
1069589645 10:69633962-69633984 CAGCCTCTTTCACCCTCCAGAGG + Intergenic
1069615452 10:69803468-69803490 CAGCCTCTTTGTGCCACCAGAGG + Intronic
1073864391 10:107785128-107785150 CAGCAGCCTTGTCCCTTCTTTGG + Intergenic
1074081997 10:110175543-110175565 CAGCCTCATTGTCCCAGCTGAGG - Intergenic
1075407870 10:122206535-122206557 CAGTGGGTTTGTCTCTCCTGAGG - Intronic
1076795834 10:132798205-132798227 CAGCCGCCTCGGCCCACCTGCGG - Intergenic
1077492566 11:2868904-2868926 AAGCCCCTTTGTTCCTCCTTGGG + Intergenic
1082641024 11:55661840-55661862 AAGTCCCTTTGTCCCTCCTCTGG + Intergenic
1083921952 11:65786133-65786155 CAGCCGCCTTTGCCCTGCTGCGG - Intergenic
1084043477 11:66555881-66555903 CAGCCACTGTGGCCCTCGTGAGG - Intronic
1084575118 11:69984254-69984276 CATCCTCTTTTGCCCTCCTGGGG + Intergenic
1087626603 11:100603515-100603537 CAGGGGCTTTGTCCCTTCTCAGG - Intergenic
1090043414 11:123310400-123310422 CACCTGCTTTGTCTCTTCTGAGG + Intergenic
1091278481 11:134368618-134368640 CATCCCCTTTCTCCCTCCTCCGG + Intronic
1092193612 12:6536364-6536386 CAACCTCTTGGGCCCTCCTGGGG + Intronic
1094843582 12:34351927-34351949 CAGCCTCTTTGCCCCCCGTGGGG + Intergenic
1095943993 12:47743725-47743747 TAGCCGCCCTCTCCCTCCTGGGG - Intronic
1096004450 12:48157626-48157648 CAGCAGCTTTCGCCCTCCAGAGG + Intronic
1100106023 12:91173329-91173351 CTGCCTCTCTCTCCCTCCTGGGG + Intronic
1101715681 12:107309856-107309878 TAACCGCCATGTCCCTCCTGTGG - Intergenic
1104987764 12:132606585-132606607 CAGCCGGTGTGTGCCTGCTGCGG + Intronic
1105263060 13:18794043-18794065 CAGCTGCTGTGTCCATCCTCAGG - Intergenic
1105888108 13:24659874-24659896 CAGCAGCTTTGTCCCTCTAGGGG + Intergenic
1107723914 13:43277872-43277894 CAACCTCTCTGTGCCTCCTGAGG - Intronic
1112119945 13:96398770-96398792 CAGAAGCGCTGTCCCTCCTGTGG + Intronic
1112686286 13:101831589-101831611 AAGCCATTTTGTCTCTCCTGGGG - Intronic
1113317955 13:109204026-109204048 CAGCTGCTTTTTTCCTCCCGGGG - Intronic
1115537197 14:34384554-34384576 CAGCTGGTAGGTCCCTCCTGGGG - Intronic
1118445761 14:65849960-65849982 CAGCTGCTTTGGCCTTCCAGTGG - Intergenic
1119526345 14:75325426-75325448 TAGCCACTTTTTCCCTCTTGGGG + Intergenic
1120181923 14:81352577-81352599 ATGCAGCTCTGTCCCTCCTGTGG - Intronic
1122046645 14:99028770-99028792 CAGCAGCAGTGTCCCTCCTCTGG + Intergenic
1127158068 15:56150089-56150111 CAGCAGCTTTGTTTATCCTGTGG - Intronic
1129958347 15:79659886-79659908 CTGCTCCATTGTCCCTCCTGCGG - Intergenic
1130299086 15:82666596-82666618 CACTCCTTTTGTCCCTCCTGTGG - Intronic
1131352770 15:91716981-91717003 CACCCGCTCTGTCCCTCGTGGGG + Intergenic
1131554153 15:93382363-93382385 CAACAGCCTTGTCCCACCTGTGG - Intergenic
1132602060 16:777732-777754 CTGTCCCTCTGTCCCTCCTGTGG + Intronic
1132887895 16:2190444-2190466 CAGCAGCTTTGTGCCTGCCGGGG - Intronic
1133275795 16:4637786-4637808 CATCCGAATTCTCCCTCCTGTGG - Intronic
1139378560 16:66515963-66515985 CAGCCTCTGTCTCCCTCCAGTGG + Intronic
1141486281 16:84342369-84342391 TAGCCGCTTGCTCCCTGCTGGGG - Intergenic
1142178928 16:88657823-88657845 CTGCCTCTGTGCCCCTCCTGAGG - Intronic
1145171986 17:20666207-20666229 CAGCCTCTGTGTGCCACCTGGGG + Intergenic
1146943484 17:36859538-36859560 CAGCAGCGTTCTCCCTTCTGGGG - Intergenic
1147310271 17:39592016-39592038 CAGCCCCTTTTTCCATCCTGTGG - Intergenic
1147455292 17:40534135-40534157 CAGCCGCTCTGCCCCTCCTCTGG - Intergenic
1147675914 17:42205477-42205499 CAGCCTCCCTGGCCCTCCTGAGG + Intronic
1151848966 17:76678449-76678471 CAGCCGCCTCGCCCCACCTGAGG - Intronic
1152200161 17:78940828-78940850 CAACCGCATTCTGCCTCCTGGGG - Intergenic
1152403329 17:80082640-80082662 CTGCCGGTTTTGCCCTCCTGAGG + Intronic
1154427982 18:14286743-14286765 CAGCTGCTGTGTCCATCCTCAGG + Intergenic
1154430695 18:14306253-14306275 CAGCTGCTGTGTCCATCCTCAGG + Intergenic
1156463536 18:37334734-37334756 CAGCTCCTTTCTCTCTCCTGTGG + Intronic
1157678417 18:49584563-49584585 CTCCCTCTTTGTCCCTCCTCTGG + Intronic
1161812490 19:6478753-6478775 CAGCCCCTCTCTCACTCCTGTGG - Intronic
1164995688 19:32719564-32719586 CGGCCCCTCTGTCCCTCCGGGGG + Intergenic
1165157521 19:33797093-33797115 CGGCCGCTTTGTCCCTCTGCTGG + Intronic
1166391465 19:42411058-42411080 CAGTGCCTTTGTCCCTCCTCGGG + Intronic
1167289271 19:48615538-48615560 CAGCAGCATTGACTCTCCTGGGG - Intronic
929520385 2:42644870-42644892 CTGCCTCTTTCTCTCTCCTGGGG + Intronic
929564759 2:42977408-42977430 CAGCCGCTCTGTCACTGCTGGGG + Intergenic
930257691 2:49110784-49110806 CAGCCCCCTTGTTCCTGCTGGGG + Intronic
934932647 2:98440742-98440764 CATCCTTTTTGTCCCTCCAGTGG + Intergenic
935338447 2:102037930-102037952 CCTCAGCTTTGTCCATCCTGGGG + Intergenic
936445105 2:112588869-112588891 CAGCCACTTCCTGCCTCCTGAGG + Exonic
937533461 2:122857751-122857773 CAGCCGCTCTTCCCTTCCTGAGG + Intergenic
942623031 2:177868344-177868366 GAGCCGCTTTGTTTTTCCTGTGG - Intronic
945059894 2:205899813-205899835 CAGCTTCCTTGGCCCTCCTGGGG - Intergenic
947322218 2:228933045-228933067 CAGCCCCTTTGTACCTCTGGTGG + Intronic
947713073 2:232326744-232326766 CAGCCTCTCCCTCCCTCCTGGGG - Intronic
1171209109 20:23303434-23303456 CAGCCCCTTTGGCTCTGCTGAGG + Intergenic
1172623939 20:36336848-36336870 CAGCCCCCTTCTCCTTCCTGGGG + Intronic
1175519640 20:59591783-59591805 CAGACGCCTTGGCCCTGCTGCGG - Intronic
1178340512 21:31782158-31782180 CAGCCCCTCTGTCCATGCTGTGG + Intergenic
1178969478 21:37159252-37159274 GAGCTTCTTTGCCCCTCCTGTGG + Intronic
1179643217 21:42760545-42760567 CAGCCGCTCCGCCCCTCCTAGGG + Intronic
1182098751 22:27643178-27643200 CAGCCACTGTGTCCCACCTCTGG - Intergenic
1182969933 22:34564383-34564405 GAGTCTCTTTTTCCCTCCTGTGG + Intergenic
1183309591 22:37102213-37102235 CATCTGGGTTGTCCCTCCTGTGG + Intronic
1184486592 22:44783507-44783529 CAGCCGCTCTGTCACACTTGGGG + Intronic
1184863323 22:47189153-47189175 CCGCCCCTCTGTCCCTCCTGAGG - Intergenic
1185085355 22:48737929-48737951 CAGCCCTGTTGTGCCTCCTGCGG + Intronic
949784475 3:7725338-7725360 CAGCCTCTTTTCCTCTCCTGTGG + Intronic
950791490 3:15475618-15475640 CACCCACTTTCTCCCTCCTGAGG + Intronic
953571363 3:44074307-44074329 CACCTGCTCTGTCCCTGCTGTGG - Intergenic
956755310 3:72380356-72380378 CAGTCCCTTTCTCCATCCTGGGG - Intronic
957118413 3:76057340-76057362 AAGAAGCTTTGTTCCTCCTGAGG - Intronic
960785835 3:121372172-121372194 CAGCCCCTAGGTACCTCCTGGGG - Intronic
961104309 3:124228186-124228208 CAGCTGCTTTCTTTCTCCTGAGG + Intronic
962384722 3:134923479-134923501 CAGGCCCTTTGGCCCCCCTGCGG + Intronic
962940278 3:140119074-140119096 CAGGCATTTTGCCCCTCCTGGGG - Intronic
966558845 3:181295643-181295665 CAACCGTGTTGTCTCTCCTGGGG + Intergenic
969283988 4:6191014-6191036 CAGCAGCTTTGCCCATACTGGGG + Intronic
969378661 4:6780058-6780080 CAGTAGCTTTCTCCCTCTTGTGG - Intergenic
971478373 4:27092762-27092784 CATCAGCTTTGTCCCTTCTTGGG - Intergenic
974148067 4:57970154-57970176 CAGCCTCTTCGTCCATGCTGTGG + Intergenic
983024962 4:162725624-162725646 CAGTCTCTTTGTGCCTCCTCAGG + Intergenic
986376671 5:7139038-7139060 CACCTGCTTTCTCCTTCCTGTGG - Intergenic
988450826 5:31341502-31341524 CAGGGACTTTGTCCCACCTGTGG - Intergenic
993506709 5:88717352-88717374 GAGCCACTTTGGCCATCCTGGGG - Intergenic
998231863 5:140366001-140366023 CAGCCGCTTCTTCCCCTCTGTGG + Exonic
1000208833 5:159091451-159091473 CAGCAGCTTTCTCTCTCCTTTGG - Intronic
1004516715 6:16327398-16327420 CAGCCACTTTGTCCCTCGGGAGG - Exonic
1004873282 6:19929548-19929570 GAACCTCTTTGTCTCTCCTGGGG - Intergenic
1006509355 6:34513529-34513551 CACCCACACTGTCCCTCCTGGGG + Intronic
1006904550 6:37524298-37524320 CTGCAGCTTTGTCCCACCTGGGG + Intergenic
1017880292 6:158558188-158558210 CAGCTGCCTGGTCTCTCCTGAGG - Intronic
1018469486 6:164083134-164083156 CTGCCACTTTGCCCCTCCTCTGG - Intergenic
1019205231 6:170355972-170355994 CAGGCGGTGTGTCCCTCCTGGGG - Intronic
1023766412 7:43515185-43515207 CAGCCTCTTTCTCTCTTCTGAGG - Intronic
1024030531 7:45456330-45456352 CTCCCGCTTTGCTCCTCCTGTGG + Intergenic
1024546650 7:50528154-50528176 CAGCCGCTTTGTCTCTCTCCAGG + Exonic
1026930418 7:74220369-74220391 CAGCCTGTGTGTCTCTCCTGGGG - Intronic
1027732033 7:81886450-81886472 CAGATTCTTTGTCCCTGCTGTGG - Intergenic
1032496604 7:132367668-132367690 CAGCCGATGTGTCCTTCCTCTGG - Intronic
1032738495 7:134714367-134714389 CAGCCGACTTGTCCTTCCTCTGG + Intergenic
1033152127 7:138924686-138924708 CAGCCGCTTTGTCCCTCCTGGGG - Intronic
1034625773 7:152491257-152491279 CAGCCAATTTGTCTCACCTGAGG + Intergenic
1040290721 8:46122694-46122716 CAGCCCCTTTTTCCCACATGGGG + Intergenic
1040560907 8:48522849-48522871 CAGCAGCTCCATCCCTCCTGAGG + Intergenic
1042657806 8:71119585-71119607 CAGCCCCTCTGTCTCCCCTGAGG - Intergenic
1044544457 8:93444187-93444209 CAACAGCGTTTTCCCTCCTGGGG - Intergenic
1046576702 8:116038957-116038979 CAGTGGCTCAGTCCCTCCTGTGG + Intergenic
1047040986 8:120995505-120995527 CAGCAGGGTTGTCCCTCCTGAGG + Intergenic
1048534321 8:135278177-135278199 CAGCCACTCTGTCCTTCCTCTGG + Intergenic
1049362762 8:142220051-142220073 CCGCCGCTGTGTCCCGCCTTGGG + Intronic
1052370893 9:27663398-27663420 CAGCCTCTATCTGCCTCCTGGGG + Intergenic
1054965870 9:71026332-71026354 CAGCCACCTGGTACCTCCTGGGG + Intronic
1055870072 9:80866302-80866324 CAGCCATTTTGTCTCCCCTGAGG - Intergenic
1056972719 9:91220976-91220998 CAATCGCTGTGTCCCCCCTGAGG + Exonic
1060889876 9:127181220-127181242 GAGCCTCTGTTTCCCTCCTGTGG - Intronic
1061536745 9:131255053-131255075 AAGCCCCTTGGTCCCTTCTGTGG + Intergenic
1062005733 9:134237611-134237633 CAGTCCCTTTCTCCCTCCTGGGG - Intergenic
1062294800 9:135818745-135818767 CAGCCTCTGTGTCCCGCTTGTGG - Intronic
1062411915 9:136429995-136430017 CATCCGCCCTGTCCTTCCTGCGG - Intronic
1062579982 9:137225136-137225158 CAGCCGCCTTTTCCCTCCTTGGG - Exonic
1185772406 X:2774474-2774496 CAGCTACTTTGGCCATCCTGTGG + Intronic
1189181490 X:39008867-39008889 AAGCCACCTTTTCCCTCCTGAGG + Intergenic
1190753819 X:53383507-53383529 CAACCGCTTTGTCTCTCAGGAGG + Intronic
1201781627 Y:17729472-17729494 CCGCAGCTTTGGCCCACCTGGGG - Intergenic
1201819926 Y:18176518-18176540 CCGCAGCTTTGGCCCACCTGGGG + Intergenic