ID: 1033152743

View in Genome Browser
Species Human (GRCh38)
Location 7:138930280-138930302
Sequence TCTGGGGCCCTTAAGAATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 1, 2: 21, 3: 17, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033152743_1033152748 4 Left 1033152743 7:138930280-138930302 CCATAATTCTTAAGGGCCCCAGA 0: 1
1: 1
2: 21
3: 17
4: 90
Right 1033152748 7:138930307-138930329 TCAGAATGGTCCATGAGCACTGG 0: 1
1: 11
2: 90
3: 283
4: 648
1033152743_1033152744 -10 Left 1033152743 7:138930280-138930302 CCATAATTCTTAAGGGCCCCAGA 0: 1
1: 1
2: 21
3: 17
4: 90
Right 1033152744 7:138930293-138930315 GGGCCCCAGACTTTTCAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033152743 Original CRISPR TCTGGGGCCCTTAAGAATTA TGG (reversed) Intronic
903858597 1:26351947-26351969 TCTGGGGCCCTGCAGAAGAAAGG - Intronic
909234872 1:73140020-73140042 TCTAGGTCTCTGAAGAATTACGG + Intergenic
911161871 1:94689378-94689400 TCTGGAGCCCTTTAGAAAAATGG + Intergenic
912195901 1:107396598-107396620 TCTGTGGCCCTCAACAATTGAGG - Intronic
913353181 1:117885514-117885536 TCTGTGACCCTTATAAATTATGG - Intronic
915611386 1:156996194-156996216 TCTGGGGCATTGAAGAATTTAGG - Intronic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
916191512 1:162183362-162183384 CCTGGGGTCCTTAAGAATTGTGG - Intronic
916847136 1:168663002-168663024 TCAAGGGCCCTTAAGAATTATGG + Intergenic
920662691 1:207930754-207930776 CCTAGGGCCCTTAAGAATTATGG - Intergenic
921408304 1:214806490-214806512 TCCAGGGCCCTTTAGAATTATGG + Intergenic
924397104 1:243632517-243632539 CCTAGGGCCCTTAAGAATTATGG - Intronic
924409611 1:243790048-243790070 CCTAGGACCCTTAAGAATTATGG - Intronic
924499734 1:244626041-244626063 TCTAGGGCCCTTCAGAATTATGG - Intronic
1068964708 10:62900426-62900448 TCTTGGGTCCTTAATTATTAGGG - Intronic
1070315513 10:75307771-75307793 CCTAGGGCCCTTAAGAATTATGG + Intergenic
1075148370 10:119903103-119903125 TCTGGGGTCTATAAGGATTAAGG - Intronic
1075354626 10:121759949-121759971 ACAAGGGTCCTTAAGAATTATGG + Intronic
1075847823 10:125560001-125560023 CCCAGGGCTCTTAAGAATTATGG + Intergenic
1078805264 11:14693518-14693540 CCTAGGGCCCTTAAGAATTATGG + Intronic
1079792314 11:24753938-24753960 TTTGGGGCCCTTTAGTATTGGGG + Intronic
1080171132 11:29304379-29304401 CCTAAGGCCCTTAAGAATTATGG + Intergenic
1080919353 11:36693711-36693733 TCTGTGGCTCTTAGGAATTTGGG + Intergenic
1081186198 11:40045655-40045677 TGTAGGTCCCTTAAAAATTATGG - Intergenic
1082971560 11:59028158-59028180 CCTGGGGCCCTTAAGGATTATGG - Intronic
1084318195 11:68357949-68357971 TCTGGGGCCCTGAGGAATGCAGG + Intronic
1090523252 11:127501376-127501398 TCTGGAGCTCTTAAGAATTATGG + Intergenic
1092307645 12:7317919-7317941 TCTGTAGCCCTTAAGATATAGGG + Intronic
1093207741 12:16270663-16270685 CCTGGGGCTCTGAGGAATTAAGG + Intronic
1093690841 12:22106940-22106962 TCTAGGGCCCTTAAGTATTTGGG - Intronic
1094091969 12:26660620-26660642 TTTGTGGCCCTTCAGAATGATGG + Intronic
1094857275 12:34412532-34412554 TCTGAGCCCATTGAGAATTATGG - Intergenic
1096720474 12:53517432-53517454 TTTGGGCTCCTTTAGAATTATGG - Intronic
1102590248 12:113951189-113951211 GCTGGGCCCCTTAAGCTTTAGGG - Intronic
1109819894 13:67638971-67638993 TTTGGGGGCTTTAAGATTTAAGG + Intergenic
1113396404 13:109951486-109951508 TCTGGGCCCCTCAGGAATGAAGG + Intergenic
1117946216 14:61024949-61024971 ACTGGGGCTTTGAAGAATTAAGG - Intronic
1118863066 14:69680554-69680576 TCAGGGTCCCATAAGACTTATGG + Intronic
1120426096 14:84350485-84350507 TCTGGGGTCCTTAAGAAACTTGG + Intergenic
1122753684 14:103959423-103959445 TCTGGAGCACTGAAGAAGTAAGG + Intronic
1124454433 15:29827408-29827430 CCTGGGGCCCTAGAGGATTAGGG - Intronic
1124901672 15:33829038-33829060 CCTAGGGCCCTTAAGAATTATGG + Intronic
1125342945 15:38692486-38692508 CCTGGTGCCTTTAAAAATTAGGG + Intergenic
1127858602 15:62973859-62973881 TTGGGGGCCCTTAAAATTTATGG + Intergenic
1128622723 15:69164398-69164420 ACTGGGGCCCTGAAAGATTAAGG - Intronic
1129362456 15:75032579-75032601 TGTGGTGCCCTTATGATTTATGG + Intronic
1130301661 15:82684046-82684068 CCTGGGGTCCTTAAGAATTATGG - Intronic
1133007808 16:2894492-2894514 TCTGGGGCCGTAAAGAGTTACGG - Intronic
1135197245 16:20404569-20404591 TCTGTGGCCCTTAAGAAGGAAGG + Exonic
1136926069 16:34375468-34375490 TCTGGGACCAGTAAAAATTAAGG + Intergenic
1136978505 16:35036338-35036360 TCTGGGACCAGTAAAAATTAAGG - Intergenic
1138323250 16:56137712-56137734 TCTGGGGCATTCAACAATTAGGG - Intergenic
1141979249 16:87539685-87539707 TCTGGGACCCTGAAGATTTGGGG - Intergenic
1146504859 17:33395858-33395880 TCTGGGGAGGTTAAGAAGTATGG - Intronic
1147356873 17:39905357-39905379 TCTGGGTCCCTTGAGAATATGGG + Intronic
1150719027 17:67598533-67598555 TCTGGGGCCCTTAAAACCTAAGG - Intronic
1157332184 18:46712087-46712109 TCTGGGGCCCTGCAGAACTCCGG - Intronic
1158455124 18:57599371-57599393 TTTGGGGACCTTAAAAATAATGG - Intergenic
1158757377 18:60342420-60342442 TCTAGGTCCCTTAAGAATGATGG + Intergenic
1159555124 18:69937874-69937896 TCTGGAGCCCTTAATATTAAAGG + Intronic
1159784267 18:72695395-72695417 TCTTGGGACCTTAAGAGTTGAGG + Intergenic
1163135203 19:15305645-15305667 TCCAAGGACCTTAAGAATTATGG - Intronic
1167397330 19:49239298-49239320 GCTAGGGCCCTTAAGAATTATGG - Intergenic
926163153 2:10502087-10502109 TCTGGGGACATCAATAATTAAGG - Intergenic
927324555 2:21789133-21789155 TTTAGGGCCCTCAAAAATTATGG - Intergenic
927847060 2:26477104-26477126 TCTGGGGCCCCTCAGGATCAGGG - Intronic
928057653 2:28074147-28074169 GCTGGGGCCATTAGGAATTGGGG + Intronic
935228243 2:101073066-101073088 CCTAGGGCCCTTAAGAACTATGG - Intronic
942050933 2:172140309-172140331 CCTAGGGCCCTTAAGAATTATGG + Intergenic
948797641 2:240412939-240412961 TCTGCGGCCCTTGGGAACTAGGG - Intergenic
1169756635 20:9049971-9049993 ACTAGGGCTTTTAAGAATTATGG - Intergenic
1173280397 20:41621791-41621813 TCTGGGGCCCTTTGGAAATGGGG - Intergenic
1175199680 20:57268384-57268406 TGTGGGGCCCTTAAGAGCTGGGG - Intergenic
1176969588 21:15250085-15250107 TCTGGGGGCTTTAAGATTTGTGG - Intergenic
1178349042 21:31858332-31858354 TCTGAGTCCCTTAAGAATGACGG - Intergenic
1182215066 22:28709070-28709092 TCATGGGCACTTATGAATTAAGG + Intronic
1183604641 22:38861235-38861257 TCTTGGACCCTTGAGAATAACGG - Intergenic
1184983075 22:48108625-48108647 TCTGGGGTCCTTCAGGATGAGGG - Intergenic
953413437 3:42702529-42702551 TCTGGGGCTCTTGAGACTTGTGG - Intronic
953533207 3:43756501-43756523 TCTGGGGTCCTTGGGAATTTAGG - Intergenic
954491676 3:50912776-50912798 TCTGGAGCCCTTAAGACTTAAGG - Intronic
954872883 3:53781021-53781043 TCTGGAGCCCTTAACAATGCTGG - Intronic
956750785 3:72342275-72342297 ACTGAGGCCCTGTAGAATTAGGG - Intergenic
956942117 3:74175185-74175207 CCTGGAACCCTTAAGAAGTATGG - Intergenic
958661670 3:97076792-97076814 TCTAGGACCCTTAAGAATTATGG + Intronic
960311810 3:116126028-116126050 TCTGCAGCCCTCAAGAATGAAGG + Intronic
960382780 3:116985021-116985043 CCTAGGGCCCTTAAGAATTACGG + Intronic
961579760 3:127871132-127871154 TCTGGGCCCCCTGAGAATTTGGG - Intergenic
963054085 3:141170020-141170042 CCTGGAGCCCTCAATAATTATGG + Intergenic
964308578 3:155367891-155367913 TTTGGGGCCCTCAAGAAGAAAGG + Intergenic
970751074 4:19362340-19362362 TCTGGGTCCCTTAAGAACTATGG + Intergenic
975541618 4:75518172-75518194 TAAGGGGACCTTAAGAAATATGG + Intronic
977069854 4:92371460-92371482 CCTAGGGGTCTTAAGAATTATGG + Intronic
979933713 4:126665545-126665567 TCTAGCACCCTTAAGAAGTATGG + Intergenic
980858472 4:138469643-138469665 TCTAGGGCCCTTAAGAATTATGG + Intergenic
981898350 4:149832206-149832228 TCTAGGGCCCTTAAGAATAATGG - Intergenic
981898980 4:149839424-149839446 TATAGGGCCCTTAAGAATAATGG - Intergenic
986677208 5:10196509-10196531 GCTGGGGCCATGGAGAATTATGG - Intergenic
987245374 5:16043018-16043040 CCTGTGGCCCTTAAGCATTAAGG + Intergenic
988504265 5:31808131-31808153 TCTGGGGCCATTTAGCATAAGGG + Intronic
988958887 5:36349302-36349324 TTTGAGGACCTTAAAAATTAAGG + Intergenic
989722086 5:44541132-44541154 ACTGGGGACCAGAAGAATTAGGG - Intergenic
991366907 5:65878237-65878259 TCTAGGGCCCTTAAGGATTATGG + Intergenic
992885807 5:81159004-81159026 TTTGGGGCCATTATGAATAATGG - Intronic
994466934 5:100147913-100147935 TCTATGGTCCTTCAGAATTAAGG - Intergenic
994736841 5:103566338-103566360 CCTAGGGCCCTTAAGAATTATGG + Intergenic
995339470 5:111041635-111041657 TCTAGGGCCCTTAAGACTGATGG - Intergenic
1005610613 6:27520382-27520404 ACTGGGTCTCTGAAGAATTAAGG + Intergenic
1006959593 6:37914810-37914832 CCTAGGGCCCTTAAGAATTATGG - Intronic
1010639856 6:78311346-78311368 TCAGGGGTCCTGGAGAATTAAGG - Intergenic
1014034942 6:116755775-116755797 CCTAGGGCTCTTAAGAATTATGG + Intronic
1017132622 6:151120940-151120962 TATGTGGCCATTAAGAATGAAGG + Intergenic
1018457539 6:163965220-163965242 TCTGGGGCCATTAAATATTTGGG + Intergenic
1024786089 7:52909775-52909797 GCTAGTGCCCTTAAGAATTATGG - Intergenic
1030543867 7:110867958-110867980 TCTGGAGCCCTAAAGACCTATGG - Intronic
1033066804 7:138163694-138163716 TGTGGGACTATTAAGAATTATGG + Intergenic
1033152743 7:138930280-138930302 TCTGGGGCCCTTAAGAATTATGG - Intronic
1040119299 8:43663882-43663904 TTTGGGCCCCTTAAGGACTATGG + Intergenic
1043832432 8:85005777-85005799 TCTAGTTCTCTTAAGAATTATGG - Intergenic
1044900472 8:96938513-96938535 TCTGTGCCCCTTCAGATTTAGGG - Intronic
1046478379 8:114780063-114780085 TCCGCGACCCTTAAGAGTTAAGG + Intergenic
1046777581 8:118180288-118180310 TCTGTGGCACTTAAGGAATATGG + Intergenic
1053132599 9:35625761-35625783 CCTAGGGCCCTTAAGAATTATGG + Intronic
1055058252 9:72043285-72043307 CCTGGGGCCCTGAGAAATTAAGG - Intergenic
1060768488 9:126312795-126312817 TCTGGGGCCCTTGAGCATATTGG - Intergenic
1186645920 X:11507219-11507241 TCTGTGACCCTTCAGAAATAAGG + Intronic
1193396065 X:80984854-80984876 TGTAGGTCCCTTAAGAATTATGG - Intergenic
1195776928 X:108416607-108416629 TTTGGGGCCCTTCTGTATTAGGG + Intronic
1198018086 X:132632036-132632058 CCTAGTGCCCTTAAGAAATACGG + Intronic
1199654691 X:149982729-149982751 TCAGGGGCACTTAACACTTAAGG - Intergenic