ID: 1033152986

View in Genome Browser
Species Human (GRCh38)
Location 7:138932768-138932790
Sequence GACTCCGTAGGGTCTTGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 44}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033152986_1033152990 5 Left 1033152986 7:138932768-138932790 CCCACTCAAGACCCTACGGAGTC 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1033152990 7:138932796-138932818 CTGCTATTACCATGACCCCCAGG 0: 1
1: 0
2: 0
3: 4
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033152986 Original CRISPR GACTCCGTAGGGTCTTGAGT GGG (reversed) Intronic
903596775 1:24501648-24501670 GCCTCTGAAAGGTCTTGAGTGGG + Intergenic
1069906380 10:71734876-71734898 GCCCCGGTAGGGTCTTGGGTGGG + Intronic
1079364215 11:19794998-19795020 TACTCCATAGGGTACTGAGTAGG - Intronic
1085735568 11:79036139-79036161 GAGTCAGTGGGGTCTGGAGTGGG + Intronic
1089151339 11:116366733-116366755 AAGTCAGGAGGGTCTTGAGTTGG - Intergenic
1100379817 12:94051146-94051168 GATTCCGGAGGGTTTTGAATAGG - Intergenic
1100435566 12:94568335-94568357 GTCTCCTGTGGGTCTTGAGTTGG - Exonic
1103459978 12:121096053-121096075 GACTCCCCAGGCTCTTGCGTGGG - Intergenic
1108201070 13:48043716-48043738 GCCTCTGTAGGGATTTGAGTTGG + Intronic
1113363795 13:109656865-109656887 GGCTCCGTGCGGTCTTGGGTGGG - Intergenic
1114756998 14:25270420-25270442 GACTCAGTAGGATCTTGAGATGG - Intergenic
1116706280 14:48305961-48305983 AACTCCTTTAGGTCTTGAGTAGG - Intergenic
1121114441 14:91333744-91333766 TACTCCCTAGGGTCTAGGGTGGG + Intronic
1141216940 16:82033626-82033648 TTCTCCCTTGGGTCTTGAGTTGG + Intergenic
1142328497 16:89434207-89434229 GAATCCATAGTGTCTTGAGGAGG - Intronic
1155483195 18:26312022-26312044 CACTCCATAGAATCTTGAGTTGG + Intronic
1160196053 18:76756548-76756570 GACTCCTTAGGGGCCTGAGGTGG + Intergenic
1167904622 19:52648801-52648823 GACTCCGTAGTGACTAGAGCAGG - Intronic
1168282814 19:55314607-55314629 GACTCAGTAGTCTCTTGGGTGGG - Intronic
925276599 2:2653505-2653527 GACTCCAGAGGGTGTTGAATAGG - Intergenic
925944294 2:8846472-8846494 GTCTCAGTGGGGTCCTGAGTAGG + Intergenic
927356726 2:22182023-22182045 GACTCCTCAGAGTCTTGAGGTGG + Intergenic
939656847 2:144836731-144836753 GACTCGGAAGAGTCTTGAGAAGG - Intergenic
1170944577 20:20879678-20879700 GCCTCTGAAGGGTTTTGAGTAGG + Intergenic
1179156716 21:38857495-38857517 CACTCCGCAGGGTCCCGAGTAGG + Intergenic
1182038545 22:27218533-27218555 GACTCCCTGGGATCTTGAGGGGG - Intergenic
950487299 3:13281307-13281329 GACTCCGGAGGGCCAGGAGTGGG + Intergenic
954377989 3:50205056-50205078 GACTCCGTTGAGTCTTGTGGGGG - Intergenic
955593531 3:60563182-60563204 GAAGCGGTAGGGACTTGAGTTGG + Intronic
968189839 3:196659844-196659866 GATTCCACAGGGTCTTGAGAGGG - Exonic
970669054 4:18375151-18375173 GACTCTGCAGGGTCCTGAGATGG - Intergenic
976264047 4:83173554-83173576 GACTCCCTGGGGTCTTGCGCTGG + Intergenic
979567628 4:122173347-122173369 GACTCTGCAGAGTCTTGAGGTGG + Intronic
990982951 5:61618034-61618056 GACTCCATAGAGTCTAGATTTGG - Intergenic
997460341 5:134047500-134047522 GAGTCCCTGGGGTCTGGAGTTGG - Intergenic
1004246052 6:13977132-13977154 GACTCCGCAGTGTCTTCAGGAGG - Exonic
1012290347 6:97447933-97447955 GCCTCTGTAAGGTTTTGAGTTGG - Intergenic
1017254056 6:152313389-152313411 GACTTCGTAGGGGCCTGAATAGG - Intronic
1033152986 7:138932768-138932790 GACTCCGTAGGGTCTTGAGTGGG - Intronic
1040454756 8:47585706-47585728 GACTCTGCAGAGTCTTGAGATGG + Intronic
1045378996 8:101604262-101604284 AACTCACTAGGGTCTTGCGTGGG - Intronic
1051179710 9:14397618-14397640 GACTTCATATGGTCTTGAATAGG - Intronic
1055355377 9:75432002-75432024 GACTCTGTAGGGACTTGGATGGG + Intergenic
1062618630 9:137409249-137409271 GACTCCGAAGGGTCCTGAGGCGG - Intronic
1190144821 X:47880921-47880943 GACTCTGCAGGGTCCTGAGGTGG + Intronic
1190762452 X:53447884-53447906 GACTGAGGAAGGTCTTGAGTGGG - Intergenic
1194799590 X:98255238-98255260 GACTCCCTAGGGTGTTGTTTGGG - Intergenic