ID: 1033152990

View in Genome Browser
Species Human (GRCh38)
Location 7:138932796-138932818
Sequence CTGCTATTACCATGACCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 98}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033152986_1033152990 5 Left 1033152986 7:138932768-138932790 CCCACTCAAGACCCTACGGAGTC 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1033152990 7:138932796-138932818 CTGCTATTACCATGACCCCCAGG 0: 1
1: 0
2: 0
3: 4
4: 98
1033152988_1033152990 -6 Left 1033152988 7:138932779-138932801 CCCTACGGAGTCAGAAACTGCTA 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1033152990 7:138932796-138932818 CTGCTATTACCATGACCCCCAGG 0: 1
1: 0
2: 0
3: 4
4: 98
1033152989_1033152990 -7 Left 1033152989 7:138932780-138932802 CCTACGGAGTCAGAAACTGCTAT 0: 1
1: 0
2: 0
3: 16
4: 141
Right 1033152990 7:138932796-138932818 CTGCTATTACCATGACCCCCAGG 0: 1
1: 0
2: 0
3: 4
4: 98
1033152987_1033152990 4 Left 1033152987 7:138932769-138932791 CCACTCAAGACCCTACGGAGTCA 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1033152990 7:138932796-138932818 CTGCTATTACCATGACCCCCAGG 0: 1
1: 0
2: 0
3: 4
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033152990 Original CRISPR CTGCTATTACCATGACCCCC AGG Intronic
900091558 1:923013-923035 CTGCTGTTACCAACGCCCCCAGG + Intergenic
900311849 1:2037250-2037272 CTCCTAATACCATCACCCCTGGG + Intergenic
900486198 1:2923958-2923980 CTGCTTTGCCCAAGACCCCCAGG + Intergenic
901493921 1:9610661-9610683 CTGCTGTTCCCGTCACCCCCTGG + Exonic
907875047 1:58477744-58477766 CTGATAATATCATGATCCCCTGG + Intronic
915948743 1:160173577-160173599 CTCCTGTTACCATGATCACCTGG - Exonic
916787848 1:168099131-168099153 CTGCTTCTGCGATGACCCCCAGG + Intronic
921060481 1:211579868-211579890 CTCCTATCACCATCAACCCCTGG + Intergenic
921882665 1:220272292-220272314 CTGCTACTTCCAGGACCTCCAGG - Exonic
924383822 1:243485370-243485392 CTGCTAACACCTTGAGCCCCTGG - Intronic
1070551434 10:77493721-77493743 CGGCTATGACCATGAGCCACTGG - Intronic
1075212000 10:120499506-120499528 CTGCATTTAACATGATCCCCAGG - Intronic
1077457871 11:2691828-2691850 CTGCCAGGACCATGACCCCTAGG + Intronic
1077478920 11:2803819-2803841 CTGCTATGCCCATGGACCCCAGG + Intronic
1080083225 11:28246646-28246668 TTGCTATTACCATGACAACAAGG + Intronic
1083919568 11:65774892-65774914 CTGCTATTGCCATGATCTTCGGG + Intergenic
1085376822 11:76071312-76071334 TTGCTATTCCCATGACCTTCAGG - Intronic
1093928243 12:24929986-24930008 CTGCTGTTTCCAGGACCCACGGG + Intronic
1094612255 12:32005740-32005762 CTGCTGCTGCCACGACCCCCTGG + Intergenic
1096815692 12:54200439-54200461 CTGCTCTTCCCTTGACCCCAGGG + Intergenic
1097599619 12:61674598-61674620 CTCATTTTACCAAGACCCCCTGG - Intergenic
1097709886 12:62906676-62906698 CTTCCATCACCATGACCCCAAGG + Intronic
1098137092 12:67414206-67414228 CTGCATTTACCATGATCCCCAGG - Intergenic
1098640987 12:72838608-72838630 CTGCTAATTCCATGATGCCCAGG - Intergenic
1100697510 12:97111400-97111422 ATGCTATTACCAGTAGCCCCAGG + Intergenic
1104327499 12:127813066-127813088 CTCCTAAAACCGTGACCCCCAGG - Intergenic
1115506624 14:34099559-34099581 TTGCTCTTTCCATGGCCCCCAGG + Intronic
1124169338 15:27358930-27358952 ATCCTCTTACCAGGACCCCCGGG - Intronic
1126377813 15:48013590-48013612 CTGCTATTGCCATGGCTCCATGG - Intergenic
1135938200 16:26798724-26798746 CTGCTGTGAACATGACACCCTGG - Intergenic
1136544599 16:30948314-30948336 CTGCTATTTCCATGGCAACCAGG - Exonic
1136913300 16:34161137-34161159 GTGTTATTCCCATGACCCGCTGG + Intergenic
1141634812 16:85308829-85308851 TTGCCACTACCATGACCCACAGG + Intergenic
1142767918 17:2076036-2076058 CTGCTCTTACCTAGACCCCTGGG - Intronic
1149649643 17:58268876-58268898 CTTCTTTTAAAATGACCCCCTGG + Intergenic
1152399997 17:80060181-80060203 CTGCTGTGTCCAGGACCCCCTGG - Intronic
1153158209 18:2173094-2173116 ATGCTGTTTCCATGACTCCCAGG + Intergenic
1155233114 18:23793486-23793508 CTGCCATTCCCTTGTCCCCCAGG - Intronic
1155390144 18:25327039-25327061 CTGTGATGACCATGACCTCCAGG + Intronic
1156468361 18:37362136-37362158 CTGCAGTCACCCTGACCCCCAGG + Intronic
1156881612 18:42087105-42087127 CTCCTATAACAATGAACCCCAGG - Exonic
1159810340 18:73011749-73011771 CTGGGATCACCATGAGCCCCTGG - Intergenic
1163381088 19:16969273-16969295 CTGCTATGCCAATGGCCCCCAGG + Intronic
1164827367 19:31293546-31293568 CTGCTCATTCCATGTCCCCCAGG + Intronic
925274517 2:2639313-2639335 CTGCTCCTCCCATGACCCCCTGG - Intergenic
930917438 2:56710517-56710539 CTGCTCTTACCAAGTCCCCAAGG - Intergenic
934090763 2:88548663-88548685 CTGGCATCACCATGACCCACAGG - Intergenic
934899829 2:98150662-98150684 CTTCTATTCCCATCACCCTCTGG + Intronic
936379184 2:111969003-111969025 CTGCAATGACCAGGATCCCCCGG - Intronic
936529154 2:113263334-113263356 CTCCAATTACCAGGACCTCCAGG + Intronic
938536898 2:132255080-132255102 GTGTTATTCCCATGACCCGCTGG - Intronic
942389881 2:175481193-175481215 CTCCAATTACCATGACGCCATGG - Intergenic
943153148 2:184138891-184138913 CTGCTCTCACCATGGCCCTCTGG - Intergenic
945512690 2:210722215-210722237 CTGCTAGTTCCATCACCACCTGG + Intergenic
946155002 2:217801449-217801471 CTGCGATGTCCATGACTCCCTGG + Exonic
946757972 2:222965651-222965673 CTGCTCCTACCATGCCCTCCTGG - Intergenic
947894908 2:233661326-233661348 CTGTCATTACCATTACCACCAGG + Intronic
948128851 2:235585357-235585379 CTGCTCTGACCCTGACCTCCTGG + Intronic
948270443 2:236669646-236669668 CTGCTGTGACCATGACCGCCAGG - Intergenic
948540612 2:238689336-238689358 CTGCCCTTGCCATGATCCCCAGG + Intergenic
1169662230 20:7992487-7992509 CTGCTGTTACCCTGAATCCCAGG - Intronic
1179596742 21:42447758-42447780 GTGTTCTTTCCATGACCCCCAGG - Intergenic
1180220621 21:46355881-46355903 CAGCAATCCCCATGACCCCCAGG - Intronic
1185421275 22:50735614-50735636 CTGCTTCCACCCTGACCCCCAGG - Intergenic
953434023 3:42864565-42864587 CTTCTATTACTATGACTACCTGG + Exonic
955987272 3:64587101-64587123 CTGCTTTTACAATGAAGCCCTGG + Intronic
965733899 3:171800932-171800954 CTCCTAATACCATCACCCCTTGG + Intronic
967731156 3:192908264-192908286 CTACTATGTGCATGACCCCCTGG + Intronic
968264134 3:197349617-197349639 CTGCTCTTACCTGGACCTCCAGG - Intergenic
971581843 4:28351670-28351692 CTGTTCTTACCATGCCTCCCTGG - Intergenic
982002452 4:151033458-151033480 GTGCTACTACCATGACCTACTGG + Intergenic
990779476 5:59343323-59343345 CTCCTGTTCCCATCACCCCCTGG + Intronic
992442167 5:76806506-76806528 ATGCTTTTACTTTGACCCCCAGG + Intergenic
993228854 5:85205068-85205090 CTGCTCTCACCATGAACCTCTGG - Intergenic
995712573 5:115050131-115050153 CTCCTAATACCATGACCCTGGGG + Intergenic
997353533 5:133247883-133247905 CTGCTTCCCCCATGACCCCCAGG + Intronic
997857958 5:137390315-137390337 CTGCTAATGCAATGACCCCTGGG + Intronic
998918893 5:147045823-147045845 TTGCTTTCACCATGACCCTCTGG + Intronic
1001580623 5:172795692-172795714 CTGATCTTTCCATGACCACCAGG + Intergenic
1004675172 6:17834835-17834857 CTGTTAATACCATGAGCCTCAGG - Intronic
1006887507 6:37395034-37395056 CTGCTTTTACCACCACCCACCGG + Intergenic
1012444720 6:99296278-99296300 CTGCTTTTGCCAAAACCCCCTGG - Intronic
1014690983 6:124563523-124563545 CTGCTATTTCCATGTCCACAGGG + Intronic
1015379790 6:132553466-132553488 ATGCTAGTACCGTGACCCCCAGG - Exonic
1016915224 6:149238246-149238268 CTGGCATTTCCAAGACCCCCTGG + Intronic
1023674767 7:42617846-42617868 CTGCTTTTACCTTGGCGCCCAGG + Intergenic
1033152990 7:138932796-138932818 CTGCTATTACCATGACCCCCAGG + Intronic
1036457068 8:8919047-8919069 CTGCTTTTACCTTGATCACCTGG + Intergenic
1039016394 8:33154235-33154257 CTGCTTTTAGCATGACTGCCTGG + Intergenic
1043131981 8:76473165-76473187 CTGTTCTCACCATGAACCCCTGG - Intergenic
1045063410 8:98426763-98426785 CTGTTATTATCACCACCCCCAGG - Intronic
1047283505 8:123466090-123466112 CTGCTATTGCCCTCAGCCCCTGG - Intronic
1054965804 9:71025985-71026007 CTGCTCTTACCATGGGCCTCTGG + Intronic
1055668113 9:78572499-78572521 CTGCTCTTACCAGGACCTCGTGG - Intergenic
1056803913 9:89713284-89713306 CTTCTGTTACCATGACACCTTGG - Intergenic
1058119951 9:101127373-101127395 CTGCAATCACAATGGCCCCCTGG - Intronic
1062552948 9:137098490-137098512 CTGCTCTCATCATGCCCCCCAGG + Intronic
1185971278 X:4667655-4667677 CTGCTTTTTCCATGTTCCCCAGG - Intergenic
1193984046 X:88218810-88218832 CTGCAATTAGAATGACCACCTGG - Intergenic
1195525405 X:105883441-105883463 TTGCTATTTCCATAAACCCCTGG - Intronic
1199550426 X:149056052-149056074 CTGAGATGACCATGACCCCAAGG + Intergenic
1199878868 X:151956914-151956936 CTGCTGCTATCATGACTCCCAGG + Intronic
1201077429 Y:10198344-10198366 GTGTTATTTCCATGACCCGCTGG + Intergenic