ID: 1033158784

View in Genome Browser
Species Human (GRCh38)
Location 7:138979365-138979387
Sequence CCAGATGGCCACATTCATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033158777_1033158784 16 Left 1033158777 7:138979326-138979348 CCAGAAGCACTTATATTCTCCAC 0: 1
1: 0
2: 1
3: 10
4: 129
Right 1033158784 7:138979365-138979387 CCAGATGGCCACATTCATATGGG 0: 1
1: 0
2: 0
3: 7
4: 106
1033158780_1033158784 -9 Left 1033158780 7:138979351-138979373 CCTCTGCAGTACACCCAGATGGC 0: 1
1: 0
2: 0
3: 10
4: 160
Right 1033158784 7:138979365-138979387 CCAGATGGCCACATTCATATGGG 0: 1
1: 0
2: 0
3: 7
4: 106
1033158778_1033158784 -3 Left 1033158778 7:138979345-138979367 CCACAACCTCTGCAGTACACCCA 0: 1
1: 0
2: 2
3: 15
4: 198
Right 1033158784 7:138979365-138979387 CCAGATGGCCACATTCATATGGG 0: 1
1: 0
2: 0
3: 7
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033158784 Original CRISPR CCAGATGGCCACATTCATAT GGG Intronic
900387584 1:2417570-2417592 CCAGATGCCCACATCCAGAGTGG - Intergenic
905416752 1:37808899-37808921 CCAAATGGCCACATCCTTGTGGG + Intronic
908109117 1:60877083-60877105 TGAAAAGGCCACATTCATATTGG - Intronic
910220730 1:84887397-84887419 CCATTTGGCAACATTCATAGAGG + Intronic
910252208 1:85209514-85209536 CCAGATAGGCACATCCATAGAGG + Intergenic
910371151 1:86516441-86516463 CCAGCAGGCCTCATGCATATGGG + Intergenic
911809088 1:102250939-102250961 TCAGATGCCTACATTCATACTGG - Intergenic
912452063 1:109773355-109773377 CCAGAGGGCCACATTCTGAGAGG - Intronic
1064978131 10:21139585-21139607 CCATATGTCCACATTCTTTTTGG - Intronic
1070745383 10:78930652-78930674 CCAGAGGGCCCCATTCCTTTTGG + Intergenic
1070777271 10:79117038-79117060 CCAGATGGCCTCAGTCACACGGG + Intronic
1071204978 10:83264054-83264076 CCACATGTTCTCATTCATATGGG - Intergenic
1073529692 10:104219697-104219719 CCACATGGTCACCTACATATAGG + Intronic
1074575681 10:114666942-114666964 CCAGATGTTCACATTTTTATAGG + Intronic
1075324894 10:121523442-121523464 CCAGCTGGCCTCATCCATGTGGG + Intronic
1075355173 10:121765661-121765683 CCAAACTGCCACATTCATGTGGG + Intronic
1075820054 10:125300071-125300093 CCAGCTGGCTATATTCATGTGGG - Intergenic
1075823175 10:125331349-125331371 CCAGATGGCCACTTTGACCTTGG - Intergenic
1087151354 11:94862369-94862391 CTAAATGGCCACAGTCAAATTGG + Intronic
1087270365 11:96105133-96105155 CCAAATGGACACATTTATTTTGG + Intronic
1090219182 11:125001247-125001269 TCAGTTGGCAACATGCATATTGG + Intronic
1092016483 12:5163189-5163211 CCAGATGGCCAGTGTCAAATAGG + Intergenic
1093040394 12:14372530-14372552 CCAGATTCTCATATTCATATAGG - Intronic
1096445171 12:51683381-51683403 CTAGATGGGAACATTCATACTGG + Intronic
1098510019 12:71300746-71300768 AAAGATGGCCATATGCATATGGG + Intronic
1100734780 12:97514252-97514274 CCAGATGACAACATCCTTATGGG + Intergenic
1100828650 12:98497959-98497981 CCAGAGGGCACCATTCATATTGG - Intronic
1107049622 13:36033268-36033290 CCAGATGGCCAAAATTACATGGG - Intronic
1111188456 13:84775885-84775907 CCAGATAGACTCTTTCATATTGG + Intergenic
1111306413 13:86418933-86418955 CCATGTGGCAACATGCATATAGG + Intergenic
1114483828 14:23051689-23051711 CCACATGTGCACATTCATATAGG + Intronic
1115302509 14:31900529-31900551 CCAGAAATCCACATTCTTATAGG - Intergenic
1119025367 14:71148349-71148371 CCAGAAGGCCACTTTCTTATGGG - Intergenic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1125964628 15:43864023-43864045 CCACATGACCTCACTCATATGGG - Intronic
1127871207 15:63075549-63075571 CCAGATGGCAACATTAACCTGGG - Intergenic
1133203985 16:4221920-4221942 CCATAAGGACACCTTCATATTGG + Intronic
1137353437 16:47734743-47734765 CCAGATGGGAGCATTCATACAGG - Intergenic
1138097468 16:54223304-54223326 CCAGATGGCCCCACTCACACAGG - Intergenic
1153212331 18:2780769-2780791 CCTGAACACCACATTCATATAGG - Intronic
1160172684 18:76567854-76567876 CCATAAGGACACAGTCATATTGG + Intergenic
1161964159 19:7539179-7539201 CCGGCTGGCCACATTTATTTTGG - Intronic
1164276385 19:23722384-23722406 CAGGATGGCCACAGTCAGATAGG + Intergenic
1164510628 19:28894182-28894204 CCAGATTGCCAGAGTCATCTAGG + Intergenic
925483430 2:4302288-4302310 CCAGATGGCTTCATTCTAATGGG + Intergenic
927981535 2:27377886-27377908 CCAGATTGCCACAGGCATAAGGG + Exonic
931201885 2:60105668-60105690 ATAGATGGCCACATTGCTATTGG - Intergenic
931796041 2:65711122-65711144 CCAGCTGGTCACACTCATGTTGG + Intergenic
937288325 2:120766976-120766998 CCAGGTGTCCACATTCCTACAGG - Intronic
939460072 2:142488085-142488107 CCAAAAGGCCACATTCAGGTGGG - Intergenic
942912077 2:181256055-181256077 CCATTTGGCCCCATTCATAAAGG - Intergenic
943815621 2:192250526-192250548 CCTGATGGACATTTTCATATAGG - Intergenic
944418339 2:199501380-199501402 CCAGTTGGGCACATTAGTATGGG + Intergenic
947015066 2:225610288-225610310 GCAGATGGCCACCTTCTTGTTGG + Intronic
1169693781 20:8363721-8363743 TAAGATGGCCACACTCATGTGGG - Intronic
1173151686 20:40571693-40571715 CCAGTTGGTCACTTTCCTATTGG + Intergenic
1177886098 21:26747475-26747497 GCAGATGGCCACATTCTTGCTGG - Intergenic
1182115658 22:27754918-27754940 CCACATGGCCACAGTCTGATGGG - Intronic
1184435615 22:44473321-44473343 CCAGAGGGCCACATTCTTGAGGG + Intergenic
951590276 3:24256908-24256930 TCAGATGGCCACCTTCAAATGGG - Intronic
951650365 3:24945019-24945041 CCAGTTGGGAACATTCACATGGG + Intergenic
954879972 3:53828067-53828089 TCAGTTGGCTACATTTATATGGG - Intronic
958971240 3:100612580-100612602 ACAGATGTCCACAATCATAATGG + Intronic
959067040 3:101668113-101668135 CCAAATGTCCTCACTCATATGGG + Intronic
961833075 3:129634433-129634455 CCTGATGGCTACATTCAGAGAGG - Intergenic
962850845 3:139307233-139307255 CCAGAAGCCCACATTCAGCTGGG - Intronic
965360335 3:167731887-167731909 CCAGGTGGCCACATTTAGGTAGG + Intronic
969897038 4:10315084-10315106 CCAGATCACCACATATATATAGG + Intergenic
970219099 4:13790245-13790267 CCAAATGCCCATATTCATAAAGG + Intergenic
973547142 4:51993289-51993311 CTAGTTGCCCAAATTCATATAGG - Intergenic
981596954 4:146435361-146435383 CCACATGGCCAGATTTATTTTGG + Intronic
981717655 4:147767384-147767406 CCACATGGCAAAAATCATATAGG + Intronic
982275855 4:153636485-153636507 CCATATGTCCAGGTTCATATAGG - Exonic
986703858 5:10439173-10439195 CCAGTTGTCCACATACATGTTGG - Exonic
990641890 5:57795029-57795051 ACAGAGAGCCAGATTCATATAGG + Intergenic
992436387 5:76759594-76759616 CCAGGTGGCCACATTCCTAAGGG + Intergenic
994517807 5:100793453-100793475 CTAGATGGTCACATAGATATTGG - Intergenic
997192525 5:131951240-131951262 TACGATGGTCACATTCATATTGG - Exonic
998511980 5:142721311-142721333 CCAGGAGGCCACATTCACCTTGG + Intergenic
1000868123 5:166540274-166540296 CCAGATAGGCCCATTCATTTGGG - Intergenic
1000978477 5:167790805-167790827 CCAGGTGGCAATATTCCTATGGG + Intronic
1003073600 6:2963776-2963798 CCTGATGCCCACATGCATACAGG + Intronic
1006844319 6:37051826-37051848 ACAGATGGCCCCACTCACATGGG - Intergenic
1008376201 6:50794953-50794975 CCAGCTGGTCACATTTTTATGGG - Intergenic
1010357378 6:74949570-74949592 CAAGATTCCCACCTTCATATTGG + Intergenic
1010921044 6:81681064-81681086 CCATAGGGTCAAATTCATATAGG + Intronic
1012742221 6:103032509-103032531 CCAGATTCCCTCAATCATATTGG + Intergenic
1015080174 6:129214578-129214600 TCAGATGGCCATATTCATGCGGG + Intronic
1015855515 6:137620273-137620295 CCAGTTGGTCATATTTATATGGG - Intergenic
1016671639 6:146716219-146716241 CTAGATGGACATATTCTTATAGG - Intronic
1016693847 6:146969537-146969559 CCAGAGGGTCACAGTCAAATAGG - Intergenic
1017361911 6:153583335-153583357 CTAGAATGCCACCTTCATATGGG - Intergenic
1018265111 6:162016027-162016049 CCAGATGGAGACCTTCATCTTGG - Intronic
1021093841 7:16512601-16512623 GCAGATGGCCACCTTCTTGTTGG - Intronic
1022902551 7:34825254-34825276 CCATATGGGCACAGACATATGGG - Intronic
1027860646 7:83574825-83574847 CCAGCTGACCACAGTCACATGGG + Intronic
1031074428 7:117199209-117199231 CCAGGTGCCCACAGTCATAGAGG + Intronic
1033158784 7:138979365-138979387 CCAGATGGCCACATTCATATGGG + Intronic
1039648000 8:39307996-39308018 CCAGGTAGCCACTTTCCTATTGG - Intergenic
1039684344 8:39781185-39781207 CCATATGTACACATTCATGTAGG + Intronic
1041033568 8:53763600-53763622 CCAGATAGCCAAAATCATCTTGG + Intronic
1046289597 8:112139433-112139455 GCAGATGGCCACAGTCAGATGGG - Intergenic
1046854229 8:119011277-119011299 TCAGTTGGCCATATTTATATGGG + Intronic
1047374425 8:124282490-124282512 CCAGATAGCCTCATTCATTTGGG - Intergenic
1052032417 9:23643800-23643822 CCAGATGGCCACATCCTTCAGGG - Intergenic
1054331721 9:63764143-63764165 TCATATGTCCAAATTCATATGGG - Intergenic
1055197979 9:73620222-73620244 CCTGATGGCCACCTCCCTATGGG + Intergenic
1056287673 9:85107853-85107875 CCACTGGGCCACACTCATATGGG + Intergenic
1059254795 9:112919893-112919915 CAAGTTGGTCACATTCATCTGGG - Intergenic
1202799095 9_KI270719v1_random:157143-157165 TCATATGTCCAAATTCATATGGG - Intergenic
1186986116 X:15015622-15015644 CCAGATGGGCACAATCTTGTGGG + Intergenic
1193742861 X:85239706-85239728 TCAAATGGCCATATTCATGTAGG - Intergenic
1196616408 X:117770981-117771003 GCAAATGGCCAATTTCATATTGG + Intergenic
1198220313 X:134593215-134593237 TCAGTTGGCCATATTTATATGGG + Intronic