ID: 1033163252

View in Genome Browser
Species Human (GRCh38)
Location 7:139015889-139015911
Sequence CCATTCCCACAGGAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033163247_1033163252 1 Left 1033163247 7:139015865-139015887 CCTCATCACATGAATAAGTAATA No data
Right 1033163252 7:139015889-139015911 CCATTCCCACAGGAGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033163252 Original CRISPR CCATTCCCACAGGAGGTGGA TGG Intergenic
No off target data available for this crispr