ID: 1033165573

View in Genome Browser
Species Human (GRCh38)
Location 7:139036034-139036056
Sequence GCTCGCTGCGCCGCGCGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 59}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033165573_1033165579 -10 Left 1033165573 7:139036034-139036056 CCTGTGCGCGCGGCGCAGCGAGC 0: 1
1: 0
2: 0
3: 14
4: 59
Right 1033165579 7:139036047-139036069 CGCAGCGAGCCGGGGCGGGCAGG 0: 1
1: 0
2: 3
3: 44
4: 402

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033165573 Original CRISPR GCTCGCTGCGCCGCGCGCAC AGG (reversed) Intergenic
904942770 1:34176895-34176917 GCTCGGTGCGCGGGGCGCCCTGG - Intronic
906614591 1:47225673-47225695 TCTCGCGGCGCCGCCCCCACCGG + Exonic
906680949 1:47725212-47725234 GATGGCTGCGCCGCGCGCTCCGG - Intergenic
907277942 1:53327374-53327396 TCTCTCTCCGCCGCGCGCAGGGG + Intronic
910985734 1:93003008-93003030 GCTCTCTGCTCCACGCACACTGG + Intergenic
916890296 1:169106768-169106790 GGTGGCTGCGGCGCGCGCCCTGG - Exonic
1067972822 10:50991749-50991771 GCTCGCTGCGGCGCGCGGAGTGG + Intronic
1074618441 10:115093336-115093358 GCTCCGAGCGCCGCGCGCCCAGG - Intergenic
1077090853 11:777607-777629 GCCCGCCGCTCCGCGCGCCCGGG + Exonic
1079131462 11:17749252-17749274 GCTCACTGCACTGCGAGCACTGG + Intronic
1086438014 11:86800601-86800623 GCTCGCTGCGCCGCTCAGACAGG - Exonic
1098369288 12:69739365-69739387 GCTCCCTGCCCCGGGCGCGCGGG - Intronic
1102136941 12:110583195-110583217 ACGCGCTCAGCCGCGCGCACCGG + Exonic
1104961456 12:132490265-132490287 GATCGCCGCGCCGCGCGCATGGG + Exonic
1104969748 12:132525872-132525894 GCCCGCTGCGCCCCGCACAAGGG + Intronic
1107468030 13:40666656-40666678 GCCCGCGGCGGCGCGCGCGCCGG + Intergenic
1114659271 14:24334511-24334533 GCTCGCGGCGCTGCTCGCAGTGG - Exonic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1128199406 15:65792023-65792045 GCTCGATCCGCTGCTCGCACGGG - Exonic
1132406408 15:101544037-101544059 GCCCCCTGCCCCGCGCGCGCAGG + Intergenic
1139496933 16:67326766-67326788 GGTCGCGGCGGCGCGCGCGCGGG + Intergenic
1140927619 16:79599291-79599313 GCCCGCGGCGCCGGGCGCGCCGG + Exonic
1142120269 16:88383456-88383478 GCTCGCTGCCCCGCACGTCCGGG - Intergenic
1149672118 17:58423764-58423786 GCTCCCTGGGCCGGGCGCAGTGG - Intronic
1152655781 17:81518673-81518695 CCTCGGTGCCCCGCGCACACTGG - Intronic
1152716318 17:81902427-81902449 GCTGGGAGCGCCGCGCGTACGGG - Exonic
1153935207 18:9914545-9914567 CCTCGCTGCGGTGCGCGCGCCGG + Intronic
1155152862 18:23136125-23136147 GCTCGCCGCGCCGGGCACGCCGG + Exonic
1157610405 18:48951840-48951862 GCTCGCCGCGCCGCACTCAGGGG + Intergenic
1159241765 18:65751022-65751044 GCGCGCGGAGCTGCGCGCACTGG + Exonic
1161925156 19:7294209-7294231 GCTCTCGGCCCCGCGCGCTCTGG + Intergenic
1162145514 19:8610684-8610706 TCTCGCCGCCCCGCGCGCGCAGG + Intronic
1163117301 19:15196176-15196198 GCTCCGGGCGCCGCGCGCGCCGG + Intronic
1163427196 19:17246045-17246067 GCGCGCGGCGCCGGGCGAACGGG + Intronic
1165157466 19:33796879-33796901 GCTCGCTGCGCGGGTCGCTCCGG - Intronic
1165773610 19:38392086-38392108 GCTGGCTGCGCTGGCCGCACTGG + Exonic
927215858 2:20667456-20667478 GCGCGCCGCGCCGCGGGCTCCGG + Exonic
937953103 2:127403324-127403346 TCTCACTGTGCCACGCGCACTGG - Intergenic
938368846 2:130756272-130756294 GCTCCCGGCGCCGCGCGCCGCGG - Exonic
938617006 2:133009780-133009802 GCTCTCTGGGCCGGGCGCAGTGG + Intronic
1169914675 20:10673528-10673550 CATCGCTGCGCCGCGCGCCGCGG + Exonic
1170617770 20:17968328-17968350 GCTCGCAGGGCCGCCCGCCCAGG + Intronic
1179209704 21:39314176-39314198 GCTCGCCGCGCCTCCCGCAGAGG + Intronic
1180018213 21:45101269-45101291 GCTCGCTGTGCCCTGCGCGCGGG + Intronic
1183324131 22:37182349-37182371 GCTCGCTGGGCTGCGCGTACAGG + Exonic
1184833623 22:47007266-47007288 GCTCGCTGTGCCTAGGGCACTGG + Intronic
1185055535 22:48576755-48576777 TCTCGCTGCCCCGCGCCCATCGG + Intronic
1185320382 22:50197955-50197977 GCTCGAGGCGCCGCGCGGCCTGG - Exonic
951640355 3:24829286-24829308 GCTCGCTGCGCCCCGCCCCCTGG - Intergenic
954912798 3:54122727-54122749 GCTCGCCGCGCCGCGCGTCCCGG + Exonic
957082433 3:75648046-75648068 GCTAACTGCGCCGAGCACACAGG + Intergenic
968583872 4:1406988-1407010 GCTCGCTGGCCCGCGCGCCCTGG - Intergenic
975689176 4:76948665-76948687 CCTCGCTGCCCTGCACGCACCGG + Intergenic
978576717 4:110196777-110196799 GCCTCCTGGGCCGCGCGCACCGG - Intronic
985480901 5:109589-109611 GCTCGCAGCTCCACGCCCACAGG - Intergenic
985727453 5:1523679-1523701 GCTCCCGGGGCCGCGCGCCCTGG + Intronic
991263448 5:64690689-64690711 CCTCGCCGCGCCGGGGGCACTGG - Exonic
998166646 5:139848198-139848220 GCTGGCGGCGCAGCGCGCACGGG - Exonic
998406270 5:141876367-141876389 GCCCGCTGCGCCGCTCGCGCCGG - Intronic
1002638388 5:180619196-180619218 GCCCGCGGCGCCCCGCGCCCGGG + Intronic
1005953388 6:30647361-30647383 GCGCGCTCCGCCCCACGCACCGG - Exonic
1019343648 7:519702-519724 CCTCGCTGCGCCGCCCGCGCGGG + Intronic
1020026051 7:4900850-4900872 GCTCCCTGGGCCGGGCGCAGTGG + Intergenic
1021162922 7:17298628-17298650 CCTCCCGCCGCCGCGCGCACCGG - Exonic
1026477281 7:70747771-70747793 GCTCGCTGGGCTGGGCGCAGTGG - Intronic
1033165573 7:139036034-139036056 GCTCGCTGCGCCGCGCGCACAGG - Intergenic
1035022981 7:155809758-155809780 ACTCTCGCCGCCGCGCGCACAGG - Intronic
1038554016 8:28494184-28494206 GCTCTCCGGGCCGCGCGCCCCGG + Exonic
1045432135 8:102124112-102124134 GCTCGGTGCGCCGCGGGCGCAGG - Intronic
1049354522 8:142181076-142181098 ACTCGCTGAGCCGCGAGCGCTGG + Intergenic
1050512969 9:6413721-6413743 GCTCTGTGCGCCGCGCGCGCAGG + Intronic
1054781910 9:69173920-69173942 GTTCGCTCCGCGGCGTGCACTGG - Intronic
1055945434 9:81688369-81688391 GCGCGCTCCGCCGGGCGCACCGG + Exonic
1062462090 9:136666301-136666323 CCTGGCTGCGCCGCAGGCACTGG - Intronic