ID: 1033172214

View in Genome Browser
Species Human (GRCh38)
Location 7:139094171-139094193
Sequence GTGGGGGCCCAGGAATCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033172214_1033172225 11 Left 1033172214 7:139094171-139094193 CCATTAGATTCCTGGGCCCCCAC 0: 1
1: 0
2: 1
3: 19
4: 133
Right 1033172225 7:139094205-139094227 TGAATCAGTAAATCTAGGGTTGG No data
1033172214_1033172223 6 Left 1033172214 7:139094171-139094193 CCATTAGATTCCTGGGCCCCCAC 0: 1
1: 0
2: 1
3: 19
4: 133
Right 1033172223 7:139094200-139094222 GTGTCTGAATCAGTAAATCTAGG 0: 1
1: 2
2: 10
3: 105
4: 768
1033172214_1033172226 14 Left 1033172214 7:139094171-139094193 CCATTAGATTCCTGGGCCCCCAC 0: 1
1: 0
2: 1
3: 19
4: 133
Right 1033172226 7:139094208-139094230 ATCAGTAAATCTAGGGTTGGAGG 0: 1
1: 0
2: 1
3: 14
4: 137
1033172214_1033172224 7 Left 1033172214 7:139094171-139094193 CCATTAGATTCCTGGGCCCCCAC 0: 1
1: 0
2: 1
3: 19
4: 133
Right 1033172224 7:139094201-139094223 TGTCTGAATCAGTAAATCTAGGG 0: 1
1: 0
2: 3
3: 38
4: 414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033172214 Original CRISPR GTGGGGGCCCAGGAATCTAA TGG (reversed) Intronic
900518253 1:3093468-3093490 TTGGGGGCCCTGGAATCAAGTGG + Intronic
903005263 1:20294038-20294060 GTGGGTGCCCAGTGATCCAATGG - Intronic
904412135 1:30330880-30330902 GAGGGGCCCCAGGAACCCAAAGG + Intergenic
907334498 1:53691420-53691442 GAGTGGGCCCAGGATTCTGAGGG - Intronic
908248401 1:62245968-62245990 GTATGGGCCCAGGAGTTTAATGG + Intronic
914195907 1:145448073-145448095 GTGGTTGCCCAGGAAGCTCAGGG + Intergenic
915329462 1:155101092-155101114 GTTTGAGCCCAGGAATTTAAGGG - Intergenic
916091349 1:161309952-161309974 GTGGGGGACCAGGAACTGAACGG + Exonic
920374324 1:205499262-205499284 GTGTGGGGCCTGGAAGCTAAAGG + Intergenic
921308385 1:213819453-213819475 GATGGGGCCCAGGAATCTGAAGG + Intergenic
1062971659 10:1653425-1653447 GTGGGGTCCCAGGAATGTTGGGG + Intronic
1063350619 10:5351212-5351234 GTGAGGGAGGAGGAATCTAAAGG + Intergenic
1063936700 10:11085812-11085834 GTGGTGACCCAGGATTCAAATGG - Intronic
1064434182 10:15296616-15296638 GAGGGGACCCAGGAAGCTAGGGG - Intronic
1065585098 10:27210229-27210251 GTGGAGGTCCAGGATGCTAAAGG - Intronic
1067091964 10:43271688-43271710 GTGGGGGCTCAGCGATCTAGAGG - Intergenic
1067752270 10:48979466-48979488 ATTGGGGCCCAGTAAGCTAACGG + Intronic
1070695456 10:78559991-78560013 GTGAGGCTCCAGGAAGCTAATGG - Intergenic
1074386793 10:113023029-113023051 GTGGGGGCTCAGTAGTCCAAAGG + Intronic
1077887312 11:6395480-6395502 GTTGGGCCCCAGGGAACTAAAGG - Exonic
1078443647 11:11387774-11387796 GTGGGGGCTCAGGACTCAGATGG + Intronic
1079640119 11:22794810-22794832 GTAGGGGGCCAGAAATCAAACGG - Intronic
1081745656 11:45470776-45470798 GAGGGGGCACAGGAACCAAAAGG + Intergenic
1082852983 11:57781841-57781863 GAGGGGGCCCAGGACTGAAAGGG - Intronic
1083900132 11:65639616-65639638 CTGGGGGTACAGGCATCTAATGG - Intronic
1084646004 11:70458483-70458505 GTGTGGGGCCAGGAATATATGGG - Intergenic
1089581466 11:119484147-119484169 AGGGGGTCCCAGGAATCTGAGGG + Intergenic
1092786812 12:12033863-12033885 CTAGGACCCCAGGAATCTAAGGG - Intergenic
1097372907 12:58805867-58805889 GTGGGGTCCCAGGAAACTTAAGG - Intronic
1101049548 12:100847050-100847072 ATGGAGGCCCAGGATGCTAAGGG - Intronic
1102107139 12:110335213-110335235 GTGAGGCCACAGAAATCTAAGGG - Intronic
1103904171 12:124319049-124319071 GTGGGGGCCCAGGAGTGTCTGGG - Intergenic
1103958259 12:124591803-124591825 GTGAGGGCCCAGAAATGTCAGGG - Intergenic
1104127561 12:125861981-125862003 TTGCGGGCCCAGGAATCTTCTGG + Intergenic
1106499635 13:30315478-30315500 GTGGGGGCACAGGGTTCTATGGG - Intergenic
1108087084 13:46804698-46804720 ATGGTGACCCAGGACTCTAAAGG + Intergenic
1108715839 13:53077026-53077048 GAGTGGGCCCGGGAATCTGAAGG + Intergenic
1111470537 13:88675038-88675060 GTGGGTTCCCAAGAATCTAGTGG + Intergenic
1119294235 14:73520218-73520240 CTGGAAGCCCAGGCATCTAAGGG + Intronic
1122240717 14:100365036-100365058 GTGGGAGCCCAGGAGTTTGAGGG + Intronic
1122445736 14:101767201-101767223 GTGGTGGCACTGGAATGTAAAGG - Intronic
1129512694 15:76136721-76136743 ATGGTGCCCCAGGAAGCTAAGGG + Intronic
1130036286 15:80364638-80364660 ATAGGGGCCCAGGAAGCTCATGG + Intronic
1131568775 15:93510718-93510740 GTGAGTGCAAAGGAATCTAAAGG + Intergenic
1132053987 15:98635231-98635253 GTGGTGTCCCTGGAATCTGAGGG - Intergenic
1133114271 16:3567272-3567294 GTGGGGCCCCAGGAACTCAATGG + Intronic
1133929760 16:10222733-10222755 GTAGGGGCCCTGGAATCCCAGGG - Intergenic
1134399188 16:13893196-13893218 ATGTGGGGCCAGGAATCAAAGGG + Intergenic
1136008409 16:27346788-27346810 GTGGGGGGCCAGGAAGCAAAGGG - Intronic
1140760129 16:78102326-78102348 GTGAGGGTCCAGGAATGTGAAGG + Intronic
1143453963 17:7053827-7053849 TTGGGGGCCCAGTAAGCAAATGG + Intergenic
1144478742 17:15611767-15611789 GGGGGGGCGCAGAAATCTAATGG + Intronic
1146885857 17:36470496-36470518 GTAAGGGCCTAGGAAGCTAATGG - Intergenic
1149826837 17:59836289-59836311 GTGAGAGCCCAGGAAGCTCAGGG - Intronic
1152246963 17:79189890-79189912 GTGGGGGCCCAACCATCCAAGGG - Intronic
1157453127 18:47802689-47802711 GCGAGGGCCCAGGAAACTGAGGG - Intergenic
1160705619 19:528878-528900 GTGGGGGCCCTGGGAACTGATGG + Intergenic
1160830527 19:1102785-1102807 GTGGGAGCCCAGGAAACTCCAGG + Intergenic
1161002932 19:1920269-1920291 ATGGGAGCCCAGGAAACCAAAGG - Intronic
1163531573 19:17852676-17852698 ATGGGAGCCCAAGAATTTAAAGG + Intergenic
1164986472 19:32652217-32652239 GTGGGGACCCAGAAATTTCAAGG + Intronic
1165404206 19:35619926-35619948 CTGGGGGCCCAGGAACTTCAAGG - Intronic
1167521590 19:49958965-49958987 CTGGGGGCCCAGGAGTCTGGAGG - Intronic
1167751082 19:51380575-51380597 GCGGCGGCCCAGGAAGCTGACGG + Exonic
1167756270 19:51415503-51415525 TTGGGGGCCCAGGAGTCTGGAGG - Intronic
925495410 2:4443243-4443265 GAGGGTGCCCATGAATCTTAAGG - Intergenic
926848305 2:17166546-17166568 CTGGGGGCCGTGGAATCTGAAGG - Intergenic
936094899 2:109523997-109524019 GAGGTGGCCCAGGACTCTGAAGG - Intergenic
936575173 2:113647401-113647423 GGTGGGGGCCAGGAAGCTAAGGG + Intergenic
941195643 2:162448422-162448444 CTGGGTACACAGGAATCTAATGG - Intronic
943722366 2:191218586-191218608 CTGTAGGCCCAGGAAACTAAAGG - Intergenic
944597678 2:201276308-201276330 GTGTGGTCCCAGGATTTTAAAGG - Intronic
946019659 2:216632708-216632730 GTGGGGGCCCAGGGTGCTAAGGG + Intergenic
946427927 2:219609229-219609251 GTGGGGGCCCAGGAGGCTGTGGG + Intronic
947281824 2:228463563-228463585 ATGAGGGCCCAGGAATCAAGAGG - Intergenic
1171520117 20:25769356-25769378 CTGGAGGCCCAGGAATGTAAGGG - Intronic
1171556802 20:26087137-26087159 CTGGAGGCCCAGGAATGTAAGGG + Intergenic
1172446944 20:34998174-34998196 ATGTGGGCCCAGGAATCAAAGGG - Intronic
1174551494 20:51365871-51365893 GTCATGGCCCAGGAATCTTAGGG - Intergenic
1174642509 20:52056732-52056754 GCTGAGGCCCAGGAATCTACAGG + Intronic
1176294712 21:5065303-5065325 CTGGGGGCCCTGGATTCTATGGG + Intergenic
1176654252 21:9575642-9575664 CTGGAGGCCCAGGAATGTAAGGG - Intergenic
1178885082 21:36478870-36478892 GTGGGGCCCCAGGTAACTGAAGG + Intronic
1179862338 21:44196823-44196845 CTGGGGGCCCTGGATTCTATGGG - Intergenic
1180903796 22:19394319-19394341 GTGAGTGCCCAGGGAACTAAAGG - Intronic
1180998827 22:19978499-19978521 GTGGGGACCCAGGACTCTGTGGG + Intronic
1181076477 22:20381244-20381266 TTGGGGCCCCAAGAAGCTAAAGG - Intronic
1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG + Intronic
1184332256 22:43834343-43834365 GTGGGGGCGCGGGAAGCTCAGGG - Intronic
1184332266 22:43834371-43834393 GTGGGGGCGCGGGAAGCTCAGGG - Intronic
1184332311 22:43834511-43834533 GTGGGGGCGCGGGAAGCTCAGGG - Intronic
1184332327 22:43834567-43834589 GTGGGGGCGCGGGAAGCTCAGGG - Intronic
1184332355 22:43834651-43834673 GTGGGGGCGCGGGAAGCTCAGGG - Intronic
1184332365 22:43834679-43834701 GTGGGGGCGCGGGAAGCTCAGGG - Intronic
1184332400 22:43834791-43834813 GTGGGGGCGCGGGAAGCTCAGGG - Intronic
1184332416 22:43834847-43834869 GTGGGGGCGCGGGAAGCTCAGGG - Intronic
1184332444 22:43834931-43834953 GTGGGGGCGCGGGAAGCTCAGGG - Intronic
1184332454 22:43834959-43834981 GTGGGGGCGCGGGAAGCTCAGGG - Intronic
1184332490 22:43835071-43835093 GTGGGGGCGCGGGAAGCTCAGGG - Intronic
1184332505 22:43835127-43835149 GTGGGGGCGCGGGAAGCTCAGGG - Intronic
1184712978 22:46263682-46263704 CTGGGCGCCCAGGGATCTCACGG - Intergenic
1185373141 22:50470038-50470060 GTGGGGGCCCAGGTGTCTGCGGG + Intronic
1185425006 22:50763497-50763519 GGTGGGGGCCAGGAAGCTAAGGG - Intergenic
950005620 3:9689271-9689293 GTGGTGGCCCAGGAACATAAAGG + Intronic
951258277 3:20476880-20476902 GGGGAGGCCTAGGAAACTAACGG + Intergenic
956399526 3:68862137-68862159 GTGGTGGCCCAGACATCTAGTGG - Intronic
960964171 3:123092943-123092965 GAGGGGGCCCAGGCCTATAAAGG + Intronic
968799997 4:2736718-2736740 GTGGAATCCCAGGAATGTAAGGG + Intergenic
972776118 4:42242164-42242186 CTGGAGACCCAGGAAACTAATGG - Intergenic
977350270 4:95875621-95875643 TTGGGGGCAGAGGAAACTAAGGG + Intergenic
981770223 4:148300058-148300080 ATGCGGGCCCAGGACTCTACAGG + Intronic
985293497 4:188410051-188410073 GTGAGGGCCTAGAAATGTAATGG - Intergenic
986157068 5:5187003-5187025 CTGGGAGCCCAGAAATCTAGTGG - Intronic
995348130 5:111144115-111144137 GTGGTAGCCCAGTAATCTGAAGG + Intergenic
997740459 5:136248495-136248517 CATGGGGACCAGGAATCTAAAGG + Intronic
998447121 5:142206812-142206834 GTGGGGGTCCAGGTAACAAATGG + Intergenic
999921277 5:156323800-156323822 GAGGGGATTCAGGAATCTAATGG + Intronic
1000882062 5:166709808-166709830 GTGGTTATCCAGGAATCTAAAGG - Intergenic
1002997031 6:2296615-2296637 GTAGGGGCACAGGAAACAAAGGG - Intergenic
1007091133 6:39185577-39185599 CTGGGCTCCCAGGAATCTGAAGG + Intergenic
1007234915 6:40383746-40383768 GAGGGGGCCCAGGTATTAAAGGG + Intergenic
1012247197 6:96938919-96938941 GCAGGGGCCCAGGAAGCTAATGG + Intronic
1016918287 6:149265538-149265560 GTGGGGGCCAAGGAAGCTTAAGG - Intronic
1018202675 6:161410187-161410209 GTGGGTGGCCAGGAATCTGAAGG + Intronic
1021760345 7:23897327-23897349 GTGTGGGCCCAGGATTCCCAGGG + Intergenic
1022710669 7:32846621-32846643 GGTGGGGCCCAGCAATCTACAGG - Intergenic
1025280605 7:57624310-57624332 CTGGAGGCCCAGGAATGTAAGGG - Intergenic
1025304125 7:57841197-57841219 CTGGAGGCCCAGGAATGTAAGGG + Intergenic
1030898063 7:115086069-115086091 GTGATGGATCAGGAATCTAAGGG + Intergenic
1031152954 7:118075761-118075783 CTGGGGGCAGAGGAATCTAAGGG + Intergenic
1033172214 7:139094171-139094193 GTGGGGGCCCAGGAATCTAATGG - Intronic
1033665668 7:143438218-143438240 ATGGGGCCCCAAGAATCTATAGG + Intergenic
1034490279 7:151389591-151389613 GTGGGGGCCCAGGACTCTTAAGG + Intronic
1035224779 7:157427073-157427095 GCGGGGGCCCAGGGACCTCACGG - Intergenic
1035473323 7:159125442-159125464 GTGGGTGCCCAGGACTGGAAAGG + Intronic
1037551452 8:19975953-19975975 GTGGCGGCAGAGGAATCTTACGG - Intergenic
1037877810 8:22556937-22556959 GATGGGGCCCAGGGATCTACAGG + Intronic
1038521165 8:28233396-28233418 GTGGAGGCTCAGGAACCTCACGG + Intergenic
1039947209 8:42140345-42140367 GTGACGGGCCAGGCATCTAAAGG - Intergenic
1040280411 8:46038961-46038983 GAGGGAGCCCAGGAATGTCAAGG + Intergenic
1040898791 8:52395485-52395507 GTAAGAGCCCAGGAATCTCATGG + Intronic
1047177065 8:122552010-122552032 GTGAGGGCAAAGGAATCAAAAGG - Intergenic
1050459833 9:5868174-5868196 GTGGGACCCCAGGAATCTATAGG + Intergenic
1051685503 9:19654350-19654372 GTGTGCTCCCAGGAAGCTAAGGG + Intronic
1057264142 9:93603030-93603052 GTGGGGGCCAAGAAATGTAGTGG + Intronic
1058668940 9:107344394-107344416 CTGGGGGGCCAGGAATCTATGGG - Intergenic
1058815795 9:108681731-108681753 GTAGGGGCTCAGGAAACTACAGG - Intergenic
1060759369 9:126234990-126235012 GTGTGGGCCCTGGAATCTGAAGG - Intergenic
1061790187 9:133055084-133055106 GTGGGGGCCCAGGCTCCCAAAGG - Intronic
1062674661 9:137733708-137733730 GTGACGGCCAAGAAATCTAAAGG + Intronic
1062698825 9:137888749-137888771 GTGGTTGCCCAGGAAGCTCAGGG - Intronic
1203631973 Un_KI270750v1:79100-79122 CTGGAAGCCCAGGAATGTAAGGG - Intergenic
1187080360 X:15979949-15979971 GCTGGAGCCCAGCAATCTAATGG + Intergenic
1191951387 X:66597494-66597516 GTGAGGCCCCAGGGATCTAGAGG + Exonic